For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:119234662+119234812 151bp CAGCGCATCCCTATCAAAGA GCAGTGGCATTGTTACCTGA
Mut = 151 bp
Wt = 151 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AGAGAAGGTGTTTAGATGGGAGAAGAGAAAGTGGTCCCCCACAAGGCCCTTCCTGGAAGCGCAGAAAGTGAAGTCTAGCCCCTGTGAGGAGTGTGTTCAGGCTACTCTTTCCAGCCCCTGGCATTTGGGCAGCAGAGCGGAGGGTCTAACAGACCCATTCACAACCTTGATCAggaggggacacagttaaactcacatacaaactatagccgtgttcactcatttgttcctgacattctttacgtaggtgagagccccagcgcatccctatcaaagagacttcccaatgggggcacgacaccgattcagactgagcatcatgggaagtctgactccctcggacacggacgatcttcccctggaaacggacgagccgcctcagcaagagtcaggtaacaatgccactgcctgcgcccgcatgttatttacaaataacagggggggggggtgctggggagatggctcgggggttaagagcaccgactgctcttccaaaggtcctgagttcaattcccagcaaccacatagtggctcacaaccatctgttgtgggatctggcgccctcttctggtgcgtctgaagaaagcaagagtgtacttacataaaacaaatctgagaggggggggggggaagaaaactaggaggatccacctagcctcgtaAGAAATGGGACAGTGGTTCTGAGTGCAGCTCACTGGTGGGACTTGCTTGGCACACACAAGGCCCAGGCTCTGGTACACAGAAATGGATGCAACACTTCACACCAGAGTCCCAGCAGTGTGAAACCTGAAGCAGGAAGACCCTTGAG
This mutation is a 489 bp deletion beginning at Chromosome 11 position 119,234,578 bp and ending after 119,235,066 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51138 | CAG CGC ATC CCT ATC AAA GA | Wild type Forward | A | |||
| 51139 | GCA GTG GCA TTG TTA CCT GA | Wild type Reverse | A | |||
| 51140 | CCC TGT GAG GAG TGT GTT CA | Mutant Forward | A | |||
| 51141 | GTG TGT GCC AAG CAA GTC C | Mutant Reverse | A | |||
| 51142 | Fluorophore-1 | CTG AGC ATC ATG GGA AGT CTG ACT | Quencher-1 | WT Probe | ||
| 51143 | Fluorophore-2 | ATC AAG AAA TGG GAC AGT GGT TCT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51138 | 0.40 uM |
| 51139 | 0.40 uM |
| 51140 | 0.40 uM |
| 51141 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.