For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:154592040-154592157 118bp CTTTCCGGAGATGGATGG GCAAATTCAGGGACAAATGA
Mut = 99 bp
Wt = 118 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GGTGAGGAAGGGGAAGGGCAGGTACTCACTAACTCGAGGTGTCAGGGAGTGACTCCAGTCTGCAGAGAGAGCTATCTATGCCCTGAGGACCTGGAGCACCCTGGCCTAGTTCAGATCTGTGTGTACATCCGAGaaacctgcctggaccagctgggcctgcactcatgggggctttctgtttgtgcagtctcagagagaagcttcaggccattctgaaagccacgtacatccactctcggaacctagcctgctttgtgtttgcctataagagtctccatgccctacagtcccatgtgcaaggcgagacccaccagatgcactctttcctggctgccttcatcggggggctcctgctgtttggagagaacaataacattaatagccaggtaaaggctttccggagatggatggggccagtggggtatcttttggttggcatctgtgtttaaggtcttaagaatctccagttcccATGTGGCCTTGTGTCTGTGTCATTTGTCCCTGAATTTGCCCACGGCGAGGGGGGGGGGTGTTTTTTGGGACAGGGTTTCCCTGTATACCCTTGTACACCTTACTCTGTAGACCAGGCTGGCCTTGAAATCGTAGAGACCTACTTGCCTTTTTCTCCTGTGTTCTGGCTTTAAAAGCATG
This mutation is a 339 bp deletion beginning at Chromosome 2 position 154,592,079 bp and ending after 154,592,417 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51133 | GCA AAT TCA GGG ACA AAT GA | Common | A | |||
| 51134 | CTT TCC GGA GAT GGA TGG | Wild type Forward | A | |||
| 51135 | ATC TAT GCC CTG AGG ACC TG | Mutant Forward | A | |||
| 51136 | Fluorophore-1 | CAG TGG GGT ATC TTT TGG TTG G | Quencher-1 | WT Probe | ||
| 51137 | Fluorophore-2 | ATC TGT GTG TAC ATC CGA GAT GTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51133 | 0.40 uM |
| 51134 | 0.40 uM |
| 51135 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.