For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr15:23226569+23226719 151bp AGCATGAGGTTTCCAGTAAAGA TGACAGAACCATCACCTTTGTC
Mut = 154 bp
Wt = 151 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CAATGTTCACTTAATACCAATTAGAGAAAAAAAAAAGAAATGAAATGGTTGCTATAGCATGAGGTTTCCAGTAAAGAATAAAACTAAAATTCTTCATCCcttgataatattcaggttacaatgccatcagaatatattcatactgagttcctctatgtgtattttctagctgcactccaactccgacaaaggtgatggttctgtcaagtacatcctgactggagaaggggccgggactatatttatcattgatgacaccacaggtgacatccactcaaccaaaagcctggacagagagcagaagactcactatgtgctccatgcccaggctattgacagacggacaaacaagcctcttgaacctgagtctgagttcatcatcaaagtgcaagatattaatgacaatgccccaaagttcacagatggaccatacatcgttactgtgcctgaaatgtcagatatgggtaaggacacttatttttatagtgaagaaatccattcccattatttgtatcaaatatatcttttaaagaattactttaatgtattttttcaaacattgagaaagctctaaaatgttataatatttttattgcagtaagaacatctattattgaaccatacattatatattgaaaaaattcttaatatggctgtgtagaaatacttgtaatatctcaagccaaagccataaCTAGTTATCATTTGCAATTCTTATTTATTTGCATTATTCTTGAATATGCAAAATTTTTCATGTTATTA
This mutation is a 595 bp deletion beginning at Chromosome 15 position 23,226,613 bp and ending after 23,227,207 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51092 | AGC ATG AGG TTT CCA GTA AAG A | Common | A | |||
| 51093 | TGA CAG AAC CAT CAC CTT TGT C | Wild type Reverse | A | |||
| 51094 | TTC AAG GCA GTT CCT GTT GA | Mutant Reverse | A | |||
| 51095 | Fluorophore-1 | CAG GTT ACA ATG CCA TCA GAA TAT ATT C | Quencher-1 | WT Probe | ||
| 51096 | Fluorophore-2 | CAT CCC TAG TTA TCA TTT GCA ATT CTT AT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 51092 | 0.50 uM |
| 51093 | 0.50 uM |
| 51094 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | repeat steps 2-3 for 40 cycles |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.