For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:95137426+95137520 95bp AAACCCTATAGCAGCCTCCA CTCAAACATTTCTGGCTTAGTATTCC
Mut = 107 bp
Wt = 95 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TTGGTAACTCAGTTAATAAAAGTGCTTGCCACACACACATAGTAAACCCTATAGCAGCCTCCAGGCTCTACCCccaagtacactgttttcaaccacacacaccaataagtttggaatactaagccagaaatgtttgagaacatctgctctacttagtgaaaaggaagaaaaagagcttgctatgttttatgaggttggtggattttactgtcagacattaatttcgttgcttttgtttgaagatggaacagattaagcgtacaaaccgcctttatactaacgactccatcttcctgaagaaaacgctctacatccccatcctatcagagcccagagacttgtttaatggtttggattctgaggaggaaaatgatggagaggaagaggtgcgcccgagtaaggatgagatcggatcatcttcggggaggaggaagaatcgagggtcagggtcgggtcggcccaatggcacaggcctcccgcctcaccaggaaacctccacccccagccatgacctttctgcctctgatttccttaagaagcttgactcacagatcagcctgtcaaagaaggctgctgcccagaagctgaggaaaggggagagtgggtgagtctctggccgctccttctagctccctgcagagaccctcttcttttagctggtcacaaactaagaagtaaccaaagtacCCGAGGACAGGCAAGTGGATGCCTTTCTCCCCATGTGGTCCCCAAATCATGAAAGAGCCAGTGGCATCTGGAATGGGGTAGTGGGTGGGAAGCAGGGTCTGTGGGGTCTTACGCCAGTGGTAGCGC
This mutation is a 614 bp deletion beginning at Chromosome 3 position 95,137,456 bp and ending after 95,138,069 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51025 | AAA CCC TAT AGC AGC CTC CA | Common | A | |||
| 51026 | CTC AAA CAT TTC TGG CTT AGT ATT CC | Wild type Reverse | A | |||
| 51027 | CCC ATT CCA GAT GCC ACT | Mutant Reverse | A | |||
| 51028 | Fluorophore-1 | CAC TGT TTT CAA CCA CAC ACA CC | Quencher-1 | WT Probe | ||
| 51029 | Fluorophore-2 | CTA CCC CCG AGG ACA GGC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51025 | 0.40 uM |
| 51026 | 0.40 uM |
| 51027 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.