For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:105338657-105338765 109bp CCCAGCTCAGGTATCAGCA ACCCCCATTTCCACATAATTG
Mut = 98 bp
Wt = 109 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CTTCCTTGAAGGCAGCCACTTCCCTCTCTCCTCCTCCATGGCCCTTCCTTATTTGTGGTTTGTTAATGCAAAAATAAAAAGCAAAAACCAACCAACCCCAACCCCCAAAataccctccagggctgtagcttgatggtttaacatgtgggcttgattcctagtagcacagaaacaaaacagacggcaaaaatctgagctgcagcaccagccctgatagttctgtccctttgtttccagctggaggactgtgcattgcaagtgtctccctccggatactacctggacccggagctgtccctagaagaacagcgggagatgctggagggtttctatgaagagatcaggtcagagttgaaagggtgagggaggccagggaacccttcccatttgaggaggtctggccagagccttcaaccccgggccccactggggcccagctcaggtatcagcagctgagatactctgtgtacagcctgggctgtaggccagtgcagagaacaatgccgggggctgGTACCCACAATTATGTGGAAATGGGGGTACTCTCATACCTCAGTACCTGTGTTTATAAAAACTCTCCTGTTCGGCTA
This mutation is a 404 bp deletion beginning at Chromosome 8 position 105,338,685 bp and ending after 105,339,088 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51020 | ACC CCC ATT TCC ACA TAA TTG | Common | A | |||
| 51021 | CCC AGC TCA GGT ATC AGC A | Wild type Forward | A | |||
| 51022 | GGC CCT TCC TTA TTT GTG GT | Mutant Forward | A | |||
| 51023 | Fluorophore-1 | CTG TGT ACA GCC TGG GCT GTA | Quencher-1 | WT Probe | ||
| 51024 | Fluorophore-2 | AAC CCC AAC CCC CAA AGT A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51020 | 0.40 uM |
| 51021 | 0.40 uM |
| 51022 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.