For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr15:97246452-97246561 110bp AAGAGACTCAGAGGCGACCA CTGCGATCACCAACAGACAC
Mut = 110 bp
Wt = 110 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GCAAGAGACTCAGAGGCGACCATAATGTCGTTAAGGTTCCACACACTGCCCAccctgcctagagctgtcaaaccgggttgcagagagctgctgtgtctgttggtgatcgcagtgatggtgagccccagcgcctcaggaatgtgccccactgcttgcatctgtgccaccgacattgtcagctgcaccaacaaaaacctatctaaggtgcccgggaaccttttcagactgattaaaagactggatctgagctataacagaatcggactgttggatgccgactggatcccggtgtcgtttgtcaagctgagcaccttaattcttcgccacaacaacatcaccagcatctccacgggcagtttctccacaaccccaaatttaaagtgtctggacttatcatccaataggctgaagtcggtaaagagtgccacattccaagagctgaaggctctggaagtactgctgctgtacaacaaccacatttcctatctggaccccgcagcgttcggggggctttcccacttgcagaaactctatctgagtgggaactttctcacacagttccctatggatttgtatactgggaggttcaagctggctgatctgacatttttagatgtttcctataatcgaatcccttccataccgatgcaccatataaacttagtgccggggagacagctgagaggcatctaccttcacgggaacccatttgtatgtgactgttctctgtactcgttgctgatcttttggtaccgtaggcactttagctccgtgatggattttaagaatgactatacctgtcgcctgtggtctgactccaggcactcccaccagctgcagctgctccaggagagctttctgaactgttcttacagcgttatcaacggctccttccacgcacttggctttatccacgaggctcaggttggggagagggcgatcgtccactgtgacagcaagactggcaatggaaatactgatttcatctgggtcggtcccgataacaggctgctggagccagataaagacatggggaactttcgtgtgttttacaacggaagtctggtcatagagaaccctggctttgaggacgccggggtatattcttgtatcgcaatgaacaggcagcggctgttaaacgagacggtggatatcatgatcaacgtgagcaatttcaccataaacagatcccacgcccacgaggcgtttaacacggcctttaccaccctggctgcctgcgtggccagtatagttctagtgctactgtatctgtacctgacgccgtgcccatgcaaatgcaaagccaagagacagaaaaacacgctgagccaaagcagtgcccactcgtccattctcagtcctggccccactggcgatgcctctgctgacgatcggaaggcaggtaaaagagtcgtgtttctggagcccctgaaggacacggcggccggacagaatggcaaagtcaagcttttccccagtgagaccgttatagccgagggcatcttaaagtccaccagggcaaagtctgactcagactcagtcaattccgtgttctcagacacaccctttgtggcatccacttaGCTGGGTGCCTGTGTTCGTCTGGTGTCGTGATTTAAAGTCTCCCTGCTTTAACTTTGGTCCGAAGAATTAATAGCAGGACGGGGTGAAAACCCTATTTTGTCTTTTGAGATGAAACCAAATGGTGTCTTTTTAAGATGGTT
This mutation is a 1531 bp deletion beginning at Chromosome 15 position 97,244,981 bp and ending after 97,246,511 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51010 | AAG AGA CTC AGA GGC GAC CA | Common | A | |||
| 51011 | CTG CGA TCA CCA ACA GAC AC | Wild type Reverse | A | |||
| 51012 | GAC CAA AGT TAA AGC AGG GAG A | Mutant Reverse | A | |||
| 51013 | Fluorophore-1 | AGA GCT GTC AAA CCG GGT TG | Quencher-1 | WT Probe | ||
| 51014 | Fluorophore-2 | CCA GCT GGG TGC CTG TG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51010 | 0.40 uM |
| 51011 | 0.40 uM |
| 51012 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.