For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:5091599+5091696 98bp GAGGTGTTGGCTCTGCTTCT CCCACATATTTGTAACCGCTGTAAG
Mut = 110 bp
Wt = 98 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GAAATCAGGCTGGTACCTGTCTAGGATGAGCAGAGGTCTTGACCGTGGTGTTAATTCTGGAGATATTGCAGGGAGCTGATGAGTTTCCTAATGGGAGGGAAGGTGATGGCTATGGTCCTGGGAGGCCCAGTAGTAGTCAGCTGGAAGGGGCAGTCGAGAGGcgcaccggggacaggacattggagagtgaagttgggatatgcagggagggaaggatgggagaggctggagcactagtggacttgaatgcctaatgaggggctctgggtgaggaagccagaggaactacttcctctcttctcttctcttggcagccatggccttcatcacatacgtgctgctggctggaatggcgctaggcattcagcaaaggttagtattctcttctccctcctggcttatgtcccttcctctgtagggaatctgtgccaggtcctagctcacccaccttgggcctaccctgacctaccttctcccatggctgcaggttctccccagaggtgttgggcctgtgtgcaagcacagcactggtgtgggtgttcatggaggtgttggctctgcttctgggcctctacctggccaccgtacgcagtgaactgagtaccttccacctcttggcttacagcggttacaaatatgtggggtgagtgcctgcaggctgagaggagcctgaagggtctcaggctacaggttttgggcctatgtagcaacagccttcactgtgatgctagagacagttctactccgtctcaaccgccagctctacgctgtgagttggtggctgtttctgacagtctccccttggagCCAGTGACTTTAAAGAGACTGGGGATTTGTTAGTTACCTTGGGGAGCCCAGAGAAGGGAAGGGGAGTTTAGGCCCTGGGACTGAGTCCTGAACCTTGCAGGTCTATTTGGAGTCTGGTTCTTTGTA
This mutation is a 646 bp deletion beginning at Chromosome 19 position 5,091,215 bp and ending after 5,091,860 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50911 | GAG GTG TTG GCT CTG CTT CT | Wild type Forward | A | |||
| 50912 | CCC ACA TAT TTG TAA CCG CTG TAA G | Wild type Reverse | A | |||
| 50913 | GGG AGG CCC AGT AGT AGT CA | Mutant Forward | A | |||
| 50914 | AAC TCC CCT TCC CTT CTC TG | Mutant Reverse | A | |||
| 50915 | Fluorophore-1 | CAC CGT ACG CAG TGA ACT GAG | Quencher-1 | WT Probe | ||
| 50916 | Fluorophore-2 | AGA GGC CAG TGA CTT TAA AGA GAC TG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50911 | 0.40 uM |
| 50912 | 0.40 uM |
| 50913 | 0.40 uM |
| 50914 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.