For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:76840606-76840718 113bp TGAAAGATCCTGTGGAGGTT CCACCATGAAGATTTCCAGA
Mut = 114 bp
Wt = 113 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GAACTGGAGGATAGAGTCAGTGCCTAGCATGTGCCCAGGCCCTGAGTTCATCCTCAGGACTGATTAAGTGAATGATTGATTGATTGAATGAATGAATGAATGAATGAAAAAAGAATAAAGGAAGAAAAAACTGAGTTTATTTATGAAAGATCCTGTGGAGGTTTTAAATGCTTGGTATTGTCTGTGCCTTctaagggtgatatgtaatttgattatgttttcaaaggtttgtgctttctggaaatcttcatggtggctcagtggtagcaagctatccttttgatgattctcccgagcataagaccactggactctatagcaaaacctccgatgatgaagtctttagatacttggcaaaagcttatgcctctaaccaccctataatgaaaactggcgaaccccattgtccaggagatgaagacgagactttcaaagatgggatcacgaatggcgcgcactggtatgacgtggaaggtatgcaaagcactgactgttgcatttccttttgttggtttagctttcttacatgtattctgaatgcaggaggaaatgtgcaatttcacttcttaaacaggttatatctttgtatgtctgaagtttccaaaactacagcaaaatttaaagacgaccacagaaatatgtactatctccagttgacctcccctgctgatctCTTAACCCATATGCTCCACCTCCCCGCCTACACATGCCCCCCCCAATTCTTCCCCAGACCACTCAAAAATATGTAGCTGACAGATCCCTTAAGTCCCTCAGCACTTGTTCTTCCAAGCACCATTCCCCCACCTGAGAG
This mutation is a 483 bp deletion beginning at Chromosome 11 position 76,840,189 bp and ending after 76,840,671 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50890 | TGA AAG ATC CTG TGG AGG TT | Common | A | |||
| 50891 | CCA CCA TGA AGA TTT CCA GA | Wild type Reverse | A | |||
| 50892 | TTT GAG TGG TCT GGG GAA GA | Mutant Reverse | A | |||
| 50893 | Fluorophore-1 | AGG GTG ATA TGT AAT TTG ATT ATG TTT TCA | Quencher-1 | WT Probe | ||
| 50894 | Fluorophore-2 | CTT CTT AAC CCA TAT GCT CCA CCT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50890 | 0.40 uM |
| 50891 | 0.40 uM |
| 50892 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.