For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:43968866+43968968 103bp GGGAGCCTGAAGAGAGATGA CCGGCTGAAGTAATACAGATGC
Mut = 95 bp
Wt = 103 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
tgttgttcgttcctctgtcattccagcttccaaacagtttaataacgaggtcctgaaggCCCACAACGAGTACCGGGCCCAGCACGGTGTCCCGCCCCTGAAGCTTTGTAAGAAGCTCAACCGGGAAGCCCAGCAGTGAGTTCCCAGCAGCCATTGGCTCGGGCCCTTTGTGGAGCTGCTTCTGcagtcatgagggcccctgggtggttgaagggatgtgatggggtctcagatatagccagacttaaggacctactcttttgctggcccaggcaggcccctttgctcaatcttctaaaaatgggatggttgggaggcccaggctatacaagacctgtgtttctgttatccctctggtgaacccagatagggaaggaggctcagcagtacaaatctcagacgttggatgttggatggtgtgtgtgtcagggatggaggtgggggtgtccccgggcggggcctgctctgaggagatacattatgcaggtattcggaggccctggccagcacgagaattctcaagcacagcccagagtccagtcgtggccagtgtggagagaaccttgcgtgggcgtcctatgatcagacaggtaggacactcagctcctccccgctctgctctgctagatctaagatgaggcctctgggcgctcctcctggcactgcccttcacagttcaatgatggtagagccacaggcccaggaagggaaagaaaacccctgaattctctgcatctgttcctgggctgacctcagtagctgccccacagccagtaggctgggagcctgaagagagatgagtcagaggagacagctcgggtgcagaagtacaagtcagaggcgcgggCGCTGGAGACTGCAGCATCTGTATTACTTCAGCCGGCTGCGGGCACCGGAGCGTCCCGTGCTTTGCTAAATTATTTATTT
This mutation is a 659 bp deletion beginning at Chromosome 4 position 43,968,272 bp and ending after 43,968,930 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49988 | AAG CCC AGC AGT GAG TTC C | Mutant Forward | A | |||
| 49990 | CCG GCT GAA GTA ATA CAG ATG C | Common | A | |||
| 50770 | Fluorophore-1 | AGC AGC CAT TGG CTC GG | Quencher-1 | MUT Probe | ||
| 50888 | GGG AGC CTG AAG AGA GAT GA | Wild type Forward | A | |||
| 50889 | Fluorophore-2 | AGG AGA CAG CTC GGG TGC A | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49988 | 0.40 uM |
| 49990 | 0.40 uM |
| 50888 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.