For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:29469774+29469932 159bp GGGTGGTGGTTTGTTTTGT CGTGGAGGGAACTGGTAATG
Mut = 129 bp
Wt = 159 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TTCTCTTCTCTTCTCTTCCTCCTCCTCCTCTTCTTCCTCTTCCTCCTCCTCCTCCATTTTTTTTTTTGTGGTGGTGGGTGGTGGTTTGTTTTGTTAATAAGGCTCTTGTGTTTCTAGACTTTCATGCAGAcacagaggggctcctatttctctctcctctgcctctcctccacaggggcagcttaaagaacacactgacttgcaccctggtcttcattaccagttccctccacgagctgatgtgtggactccaaccctgagctgtgtggttctgagctcctatgtgtagttgcttcatccaagaaaagagaaggctgaaggccttatacctccggccactgtcaattcctcttcttctcccccaacaggcaatttctaaacagggatgacattggcatcattctcatcaaccagtacatcgcagagatggttcggcacgccctggatgcccaccagaggtccattccagctgtcctggagatcccgtccaaggagcatccctacgatgcagccaaagactccatcctgcgcagggccaagggcatgttcaccgctgaagacctgcgctagggctgctcagccctcagccctcctcatcaccaggcctctcctggtttgccatgctctatttaagtgtcaagccttggtttccagcccctcccttcctcttcactgagtggctcgtaagctgttggggttcggttgttcaggtctaggctgggtagagaaagaaagcccaactgtttctccactgcctcctccctgtgctgttaatagtatcgttgttgatattaaaggaattattctctccaaatgggtactggtatggatacgtgaaggttgcagcattgggggacattagacttgcaaatatggaaaagcaaggtgaagaataattggtggggggaataattcaaggactggtcacctggatcagagactgccttcagcgatggaggacaaagtttgagcccagtctttctacctttgctgcttcacctagggtcttcacggtgctgggaggggcctgcccAAGGGACAGAAGCAATTGCCTAGGATTGTCATTGTCATTCTAGATGAGTGTTCTCAATCTGTGGCTCTCCAAAACCACAGGGGTCCCCAAGACCATCAGAGATCACTGATATTTAAATT
This mutation is a 899 bp deletion beginning at Chromosome 6 position 29,469,831 bp and ending after 29,470,729 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49998 | GGG TGG TGG TTT GTT TTG T | Common | A | |||
| 49999 | CGT GGA GGG AAC TGG TAA TG | Wild type Reverse | A | |||
| 50000 | TTT TGG AGA GCC ACA GAT TG | Mutant Reverse | A | |||
| 50001 | Fluorophore-1 | TCT GCC TCT CCT CCA CAG GG | Quencher-1 | WT Probe | ||
| 50769 | Fluorophore-2 | AGG GAC AGA AGC AAT TGC CTA GG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49998 | 0.40 uM |
| 49999 | 0.40 uM |
| 50000 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.