For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:82093116+82093212 97bp TGTGGTCACAACTAAGTCTCTATGG GGGACCCTTTTAAATCCTTAATCC
Mut = 102 bp
Wt = 97 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TCTCCTTTGTCTCTTTTTGAGACAGTCTCACTCTGGCCTGCATGTCCCAGCAATCCTCCTGTTTCAGTCTCTCAAATGCTGGGATTGTTTATAGGCACAAATCACGATAGCTGGCCTAATAATGCTGTTTGGAAACGTTATGAAATTTGTTCCTGGGAAGGCTGGTCTTGGTTGCCTTTAAGTTCGGGTCCCGGTGAGAGTATGGATCTGTGTCCCTGAccttacatagagacatgactcctgtctgatgccttctccttctctccctgcagaaaaccctgagcgagccgctctgtactttgtctctggagtgtgcattggcctgttcctgaccttggccgccttggtgatgaggatctcctgccacacggactgccggcgaggtccccggaggaggtgcttgcaggaccgcgagtgcagcgacagcagcgacagcgaggatggtagcgaggacacagcctctgacctctcggtgcgcagacaccgccgcttcgagaggactttgaataagaacgtgttcacctctgcagaggagctggagcgcgcacagcgcttggaggagcgcgaacgaatcatcagggagatctggatgaacgggcagcctgaggtgccgggcaccaggagcctgaaccgatactactagggctcagtgtgcaccccagaacctctgcagatcgccgggatgagagtgggttctgcaggcaaggacgatgtgcaagagctgaaaccagctctgttaatgtggctggagagtgcatagcgccagccagcctgtttccccaggagaatggggatttgctttagatccttgcctctggagaaatagacaacccaggcagtggcatctactctttcaggtcttgacagccacctgggcacaccagcccaatgctttcaggccttggaaaggtgctgaggaattcctctccaaccatgtgacagcgatgggacaagctgaaagtccttccgaagcgctcagaagtttgggcagacttatcctgtgctattattcctttataaaaggaaaaaaaaatctcatagctggagagctggggcatcagggtgaccgtaacccagaaaatgtaattttctaaaggactccgtgaagaggaaatggttttgattgagatagcatgatccatgctaattatttaaagctaatttttaaaacagaaaaaaaatcttgacaacctctgcattttaactgacacctcagggattaaaatcctatcttttagtctaggtcccacctcattcatgaagatgaatagaacttactgtattatgagatgtattggagacttaggatacatcaataacctcagaggataaagggttttattttttagtactctataaactatgtattgacatgtgtatttgaaaatgctgcataaaaatagaaaccgtgtgtcctttccttttggagagaaaagtctcatgacttcagagactcatgatatttaaataatattttgtttaaaaaaatagtttggatttccaagaatggaagccagaggtgagaattaaatccaaaattagaatggtatcgaaaataaacattccatgaaaatcttcttttgcttcgtgtctgtgtggtcacaactaagtctctatggttaacgaccttagttacaggcaagtatgacctctgcaggacTCCGGAAGGATTAAGGATTTAAAAGGGTCCCTGGAGTTAAGGGTTCGGGTTGTAGGTTGTAGGTTGTAGTTGAGTTATTGTTAAGCTGATAGAGGAACTGAAGGCTTAAACCTGAGGTAAGAGATCAGATAGAGACCCCACCCTCAGCCCCACCCCCTCTGTGGTGAGGAGAAATTTGTTGGACTCG
This mutation is a 1441 bp deletion beginning at Chromosome 6 position 82,091,741 bp and ending after 82,093,181 bp (GRCm38/mm10). There is a 1 bp (A) insertion at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50719 | GGG ACC CTT TTA AAT CCT TAA TCC | Common | A | |||
| 50720 | TGT GGT CAC AAC TAA GTC TCT ATG G | Wild type Forward | A | |||
| 50721 | TTC CTG GGA AGG CTG GTC T | Mutant Forward | A | |||
| 50722 | Fluorophore-1 | ACC TTA GTT ACA GGC AAG TAT GAC CTC T | Quencher-1 | WT Probe | ||
| 50723 | Fluorophore-2 | TGG ATC TGT GTC CCT GAA TCC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50719 | 0.40 uM |
| 50720 | 0.40 uM |
| 50721 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.