For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:114425857+114425996 140bp CTCCATATCCTCCCAAGTCA ACATGGTCTGTCTCTGCATACC
Mut = 150 bp
Wt = 140 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CTAAAAGTCCAAAGGAAACCCACCATGTAGTTCCTTACATAAACTAGGCTACAAATTAGATGGAAGCAGCCCAGGGTTTAAGATTACATTTTGAGTCATATGTGGCTGTGAGTTCATTATATGTCTCCTAATCCCTTtggggggcatttcaagttgtgagtgacaaattctctaagcctcaaaaacctgataaatcgggatagcaccaccatgtcttggggttgctggagttccgtgtagttattgttgtgtctggcaccaacaaaaccatcaatggtaactcttcactgtcaacccactaatcattacacaaatgtttaccaatgcttgccaggtcccgtattaggcatatcacacacaaaaggcaccgaatgacatcaccaactttcccatcttcacagtctgtctccgaggcaccaaagttcataagaagtgctaccttgcttcagaaggcctcaagcattaccacgaagccaacgaagactgcatttccaagggagggaccctggttgtccccaggaattccgacgaaatcaatgcccttcgagactatggtaagaggagtctgccaggtgtcaatgacttttggctaggcataaatgacatggtcacagaaggcaagttcctcgatgtccacggattcgctgtctccttcctcaactgggaccgtgcccagccaagtggtggcaagcgggaaaactgtgtcctgttctcccagtcagctcaggggaaatggagcgacgaagcctgtcgcagtagcaagcgatacatatgtgagtttatcatcccataagaagcccctcctccatatcctcccaagtcagactggtcagccatgataaataagctcgtaggccccctcagtaaACTCGGATTACATTTATTCATTGCAGCATCACAATGCCAGGATTGGTAGTCATAGGTATGCAGAGACAGACCATGTTTCTACCATAGCTCCTTGTAATATTACTCTTCGCATGACAAAGGGGATCAGAAAATAATGACCCAGACATGGTAAGAAAGGGACTTCTGATAATGGGCAGTCAAATTGTCTCCC
This mutation is a 730 bp deletion beginning at Chromosome 8 position 114,425,191 bp and ending after 114,425,920 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50709 | ACA TGG TCT GTC TCT GCA TAC C | Common | A | |||
| 50710 | CTC CAT ATC CTC CCA AGT CA | Wild type Forward | A | |||
| 50711 | AAG CAG CCC AGG GTT TAA GA | Mutant Forward | A | |||
| 50712 | Fluorophore-1 | AGC CAT GAT AAA TAA GCT CGT AGG C | Quencher-1 | WT Probe | ||
| 50713 | Fluorophore-2 | CAT TAT ATG TCT CCT AAT CCC TTA CTC GG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50709 | 0.40 uM |
| 50710 | 0.40 uM |
| 50711 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.