For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:35520687+35520798 112bp TTCTTCTTCGCCTGATCTCAC TTCATCTACCACACCACTGTCA
Mut = 109 bp
Wt = 112 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GAAGCCCTCCGATGTGCTTGTTTGACGTTTAACCCATCTGCCTGCTTATGTGTGGATCTCTGGAGAGATGGTGTTCTTCTTCGCCTGATCTCACTAGCCCTtaggtcgactgagcccagaaagtggatgaccacgtgtgcttagtagggacttggtggttgattgacagtggtgtggtagatgaatatatcctcctgcctcagctcagccccttgcttccaccctcccagcagctcaccttttcccctcctgtctttgaaggtctctggagctggggttctccagtgccctgagccagcaggccgagctgatctcacggcagctccaagagttgcggcggctggaggaggaagtccggtccctacgggagacctcgctgcagcagaagatgaggttggagactcaggccgtggagctggatgctctggcagtggcagagaaggccggccaagctgaggccgagggcctgcgcaccgccttggccggagctgaaatggttcggaagaacctggaagaggcgaagcacaaggagctggaggagattcagagcctgcaccaagagcaggtgaacacgggggtgggaggggcttagaagcatatcagggcacgccgtccagTAAATTGCAAGGAGCCTCGGGAGCAGCAGACCCGTGGAGGTGGGGGAAGCCCCCCAAAATACTTGGGTATTTTGGTTTCCCTCAGGCTGCACCTGTTACTTGGGAGTCAGTGAGCTCGTAACCTTCAATA
This mutation is a 516 bp deletion beginning at Chromosome 17 position 35,520,715 bp and ending after 35,521,230 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50647 | TTC TTC TTC GCC TGA TCT CAC | Common | A | |||
| 50648 | TTC ATC TAC CAC ACC ACT GTC A | Wild type Reverse | A | |||
| 50649 | GGG AAA CCA AAA TAC CCA AG | Mutant Reverse | A | |||
| 50650 | Fluorophore-1 | CCA GAA AGT GGA TGA CCA CGT | Quencher-1 | WT Probe | ||
| 50651 | Fluorophore-2 | CCC TTA AAT TGC AAG GAG CCT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50647 | 0.40 uM |
| 50648 | 0.40 uM |
| 50649 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.