For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:109721070+109721188 119bp TGCAAACTGTATTACCTGAAGTCTG CACATAAACTGGTCACTTGTTCTGA
Mut = 117 bp
Wt = 119 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AATGGTAGTTATAGCTGATTTGTGCCCACCAAGCACTGATGCAAACTGTATTACCTGAAGTCTGAAAATGTTTTTTTCATTGTAGCTGCAAACTgttaaatggacagctgctcaggatgtattcttacaaaaatcagaacaagtgaccagtttatgtgttccaggtgacagtgaaggtgacgaagaggagaccacacaagatgaagtatcttcccacacatcagaggaagatggtggggtagtcaaagtggaaaaggaattagagactgcggaagcacctgtcagtagtggggacgcactagcagagcgcgaggcaagtgcacgcaggcccggccggccggcagctttccctccgccccagcctgcaccccccgaagctctcccttcctccccagcagagtgagaactactctcaggagcttctctctcaggaggatgtcttcaggttatatcagtcaggctgtcttgtggaaccagcttccaaatacattgtatcctaaggattcatgccaggaacatgtgaaagggaatctagtcctttccctgcagagtcctgtgtcctcggggcagaaagccttgaaaattgaagaaatttaatttcttttattcaaacgatattttatccttcagtctgcagtgggaacctaagactactgaaggaggtggggcagggaagagactagtgaagagtcttcatgacttgcctgtttggtggatttgcaggtcacagaaaacctaaattctgaccccttacttcaactctgccagtgtcccctctgccagctagactgtgggagtcgggagcagctgattgcacatgtgtaccaggtatggaatggggagggagctctggggctgagtgccagcagtatagaggtcagatgctgcagtggccgttgcctctgcaaaggaagctcaggttattggttctactaggactccttcctcccctcatagcatcttaggaaataatggttgcattctcatacagatagatacactgtagaattaagtatcatggtcttgtttTACTAAATTGTTTAATACAGTCAGTAGTGAAATAAACTAAACTGACTTAACAATGACGGCTTTTAAAGTGGGGTAGGGCCAACATAAATTATATGATGTGAGTCAGTAAGATGGCTCTGGTGGTAAAGCACCTGCT
This mutation is a 935 bp deletion beginning at Chromosome 8 position 109,721,125 bp and ending after 109,722,059 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50642 | TGC AAA CTG TAT TAC CTG AAG TCT G | Common | A | |||
| 50643 | CAC ATA AAC TGG TCA CTT GTT CTG A | Wild type Reverse | A | |||
| 50644 | AAG CCG TCA TTG TTA AGT CAG | Mutant Reverse | A | |||
| 50645 | Fluorophore-1 | TGG ACA GCT GCT CAG GAT G | Quencher-1 | WT Probe | ||
| 50646 | Fluorophore-2 | CTG CAA ACT TAC TAA ATT GTT TAA TAC AGT CA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50642 | 0.40 uM |
| 50643 | 0.40 uM |
| 50644 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.