For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:32715324+32715437 114bp CTCTTTGCCAATATGGCTCTG CTCTCTTCGCCCTGGTGTTC
Mut = 106 bp
Wt = 114 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CCTGTTGAATTATAGAGTTTAATTTATGATTTTTTAAAAAGAGGAACTTAACTGACTGACTTTCTTTCTTTCTCTTTCTCTTTGCCAATATGGCTCTGTAATGTATGAAATGAGTCACTGCTTTAATTActgttcagtggataacccgggtccttcctcccttctctagtggaacaccagggcgaagagagagaaactgacagagttgatgtttgagcactacagcatccctgcattcttcctttgcaaaactgcagttttgacggcgtatccttaaactataagacagcttttctcagtgtgtgtaagacattagaggaagaagtgttttctagctttttacctgagttttttaggcatttccctactccccaccccgtttgaatcattgtatgcagtgttgggtttgggtttcataaagacagtctccttcaggtgtatcccttctccttcaagaagtatatccaatatctcCTTCAAATCGGCGACCATATTCACCCACTTCCTCTGCTTAGATTCATCTGCCCCTCTTTGCTGCCTCCCACTCTGCCTTGCAGCTTTGTGGTGG
This mutation is a 345 bp deletion beginning at Chromosome 3 position 32,715,376 bp and ending after 32,715,720 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50632 | CTC TTT GCC AAT ATG GCT CTG | Common | A | |||
| 50633 | CTC TCT TCG CCC TGG TGT TC | Wild type Reverse | A | |||
| 50634 | GGG GCA GAT GAA TCT AAG CAG | Mutant Reverse | A | |||
| 50635 | Fluorophore-1 | AGT GGA TAA CCC GGG TCC TTC | Quencher-1 | WT Probe | ||
| 50636 | Fluorophore-2 | TAA TTA CTT CAA ATC GGC GAC CA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50632 | 0.40 uM |
| 50633 | 0.40 uM |
| 50634 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.