For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:110021681+110021791 111bp TGCTGAAGTTGAGGCAGATG TCTAACAGTCTCCTTTCTACAAATCC
Mut = 105 bp
Wt = 111 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
ACTGTTAAGGAAGGAAAAAAGGTCTGGGTTTGATTACAAGTAGTAATTAACTGTTCAAGTAGGATTTTTCAGAATAAAAAAGAATCATCAATGCTGAAGTTGAGGCAGATGCATGGGGTTTGGGATGCTCCCACGGATtcttacaaaggcagtttgatgggtgaagtcattcagatggatttgtagaaaggagactgttagaagtattacattgttgctttcattgtacagctgcaggtttcccagtgggaagagttctcggtagtaagtgctcccattctctttctcgtagctgtgaagttgagtcgcaagacaaacaagagaagctggtgctgttacagcacggcagtctgacgccatgggagatgtggtttgttggcaaggagaaagaagagcgaggccggctacaacagaaatttctggaggtaaactaaacagtgtctcttcattgacccctgggcccacagagatccacctgtctctgcttcctcagtgctggaatcaaggttgtgcacagccatccccagccaaccgttctattttagtcgtcatattcaaatgtagccacagaatactaaaGGGGACTCTTGTGAAGGAAATAGAATCCAACTCTTATAACCTGCATTTTCTCCTGTGAGATATTAATATATTTCCATATCATTGAAAACATGTTTTTGTTTGTTTTGTTTG
This mutation is a 441 bp deletion beginning at Chromosome 2 position 110,021,728 bp and ending after 110,022,168 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50601 | TGC TGA AGT TGA GGC AGA TG | Common | A | |||
| 50602 | TCT AAC AGT CTC CTT TCT ACA AAT CC | Wild type Reverse | A | |||
| 50603 | TCA CAG GAG AAA ATG CAG GT | Mutant Reverse | A | |||
| 50604 | Fluorophore-1 | CAG TTT GAT GGG TGA AGT CAT TCA | Quencher-1 | WT Probe | ||
| 50605 | Fluorophore-2 | CGG ATG GGG ACT CTT GTG AA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50601 | 0.40 uM |
| 50602 | 0.40 uM |
| 50603 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.