For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chrX:101214535-101214634 100bp GAAATGGAGGGAAGGAAGGA AATAGCAGCCCAGTTGGAGA
Mut = 102 bp
Wt = 100 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
ACAGGATTATTAAAGAAAGTGAAGAGTACTTGAAGTTTATTTCCTTCATTGAGATAGTAACTCTGTCCTTCCACAGAAATCAAGTTGGATTCATATGAGCCATGCTTACTGTTCTAAGGTCTTAGCTGGACCTGGGgcattatagatcccaagcagttcttttataagaactgagaaataccctttacttagcaggtggcggcagaaggatcagaagttcaagggcatccttggctacttagacagtttgagactaccctgcagccatggaaatggagggaaggaaggagggatggaggaagagggaggacacattttaccatctcatttgctttcttctttcttgccctctccaactgggctgctatttgactgcagatcgtagtaccaccactgcctgggaaagccttgaagcggcagctccctttccgaggagatgaagggatctttgaggagtctttcattgaagaaaggaggcaaggcctcgaacagtttattaacaagtaagccaaattcttggctgctttgcatactgcttttgccattatgaaatgtttctttaccaccctcccttccccatttttctctctcctccctgtcctcctTCATTCCATACTTGGTTCTTTCCCTTTTTGCCTGGGAATGACTCCACAGCCTTGCATGTGCTAGTCAAGCACTCTACCTCTAAACTATTATACTCCCAGCCCATCATGATGTTCTTATATATATTTTTGTCTACTTTG
This mutation is a 469 bp deletion beginning at Chromosome X position 101,214,299 bp and ending after 101,214,767 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50451 | GAA ATG GAG GGA AGG AAG GA | Wild type Forward | A | |||
| 50452 | AAT AGC AGC CCA GTT GGA GA | Wild type Reverse | A | |||
| 50453 | CTC TGT CCT TCC ACA GAA ATC A | Mutant Forward | A | |||
| 50454 | AAG GGA AAG AAC CAA GTA TGG A | Mutant Reverse | A | |||
| 50455 | Fluorophore-1 | AGG AAG AGG GAG GAC ACA TTT TAC C | Quencher-1 | WT Probe | ||
| 50456 | Fluorophore-2 | AAG GTC TTA GCT GGA CCT GGG TC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50451 | 0.40 uM |
| 50452 | 0.40 uM |
| 50453 | 0.40 uM |
| 50454 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.