For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:83839230+83839333 104bp ACACCCCAGAGAACTGGTTG CGCTTGACTATACCGACCAATC
Mut = 109 bp
Wt = 104 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AGATTCACCTGCCTCTGTCCCCCCAGTGCTGGGATTAAAGGTGTGCAACACCATACCTAGCTTGAAGTTTATTCTCGCTTTTGCTATGTATGATGGAATTTCACAGCAAGAAAGCTGACACCCACAAGAAACCctgtaggttttgaaggcacggattggtgagaccaggaaattagcaaggtatttaagagaactgtagctaacttggaaaaagcacttggaaaggtaacttgtctatttctcagttgtgattttttttttctccttattcttataacttagaaactgttaaccaaattatgagggttgggaacaccccagagaactggttgaatttcttgctgaaactagagaaaaacagctcacctctaaatgacgatcttttaaataagctgattggtcggtatagtcaagcgattgaagtacttcctccagataaatacggccagaatgagagctttgctcgaatacaagtgagacttgctgaactaaaagcgtaagtattagtgaaccacacataaccaactatatatgtactatattacagagaaacagggtaaaaacaggtaatttatattttttaaactagtacttttatttttaaggtaaattttctttctgtggacatagatccctcagagttaCAGTTTGGACATTTCCAAAAATGGTACACAACTTTAATCTAGTTTTTTATTTTCACATTAAAAAAAAAAAAGAATAGTCTATCTCTTTAAAAAGAGAAGTTATCAAG
This mutation is a 511 bp deletion beginning at Chromosome 9 position 83,839,051 bp and ending after 83,839,561 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50348 | ACA CCC CAG AGA ACT GGT TG | Wild type Forward | A | |||
| 50349 | CGC TTG ACT ATA CCG ACC AAT C | Wild type Reverse | A | |||
| 50350 | TGA AGT TTA TTC TCG CTT TTG C | Mutant Forward | A | |||
| 50351 | ATT AAA GTT GTG TAC CAT TTT TGG | Mutant Reverse | A | |||
| 50352 | Fluorophore-1 | ACA GCT CAC CTC TAA ATG ACG ATC TTT | Quencher-1 | WT Probe | ||
| 50353 | Fluorophore-2 | TGA CAC CCA CAA GAA ACC CAG TT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50348 | 0.40 uM |
| 50349 | 0.40 uM |
| 50350 | 0.40 uM |
| 50351 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.