For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:85461354+85461461 108bp AAGTCCTGGAAGTGCCTGAG GTTGATCCAACTACTGCTAAGATGT
Mut = 87 bp
Wt = 108 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CTTCCTTGGTCTACCTTCAGTAGCTGTTAAGCATTGCTCTGTCCTTATTTGGCAGGCCAGCGCCAAGTCCTGGAAGTGCCTGAGAGtttcccaagtggcagacctttacattttcttaagcagcctcaggcccaggagatgtgcttaacatcttagcagtagttggatcaactgttccatgtttagcatgagactcattcaacttgtgtttttggcaggctgttaacaaaatcaaagagatagctgtgactgtgaagaagcaagataaagtgtaagtttccagggggctgtgtcagaaccttgatatcttgaggccaaatagggtattttggccaaataagcatgttgcagactttgtataagcgggtgggtggccttttggttcttgacagaccctttgatgtaaaacatgaaagagGCTGTAGACTGTCATTAAGAGCCACCGTGGGGGTGGGGGTGGGGTGACTGTATCTGCTG
This mutation is a 332 bp deletion beginning at Chromosome 6 position 85,461,376 bp and ending after 85,461,707 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50305 | AAG TCC TGG AAG TGC CTG AG | Common | A | |||
| 50306 | GTT GAT CCA ACT ACT GCT AAG ATG T | Wild type Reverse | A | |||
| 50307 | GAC CGA CAG CAG ATA CAG TCA | Mutant Reverse | A | |||
| 50308 | Fluorophore-1 | TTA AGC AGC CTC AGG CCC AG | Quencher-1 | WT Probe | ||
| 50309 | Fluorophore-2 | TGT CAT TAA GAG CCA CCG TGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50305 | 0.40 uM |
| 50306 | 0.40 uM |
| 50307 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.