For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:122112065-122112182 118bp TGTTGGTTGCATGTTGAGAC AACAAGCCGATGCACAGTTC
Mut = 139 bp
Wt = 118 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TTTATTCTAAGTGTAGGTAAGATTTTGGTGACTTACAAGAAAACAAAATATCTGAGCTTTTAATGTTGGTTGCATGTTGAGACAACATTTGGGTATGGCTAACGTGTAATGCTAGATTGGGTTTAcccttctgtaacaggatggtaagcagcagctaggaagaactgtgcatcggcttgttaagccgctggcttctcagtcatctggttactgtgttggagaatgccctctttccagccctcctgctgtacctgcgaggtggtaaccattcagacaaccttatgatttaaagggtcctgcgtatttataaactgacacttctttaactctaactcagatatttttaacactatggatggcacgcaggtagcgcaagtggacctggctcttctcagagaagattctgagcagctggagcccgccagtgtctcttcctttacatcgctgagagtgtctcaggacttggatgttctggtgctggtcagctcagccagtactgcagttgctcttaacctacatttgtatttcaggtaggtagatggctcaaatttctcatttgaggtaaatagacccataaaaggtttaaaatatactccttagctttttttaaaagcctctttgctaTGCAGTTAGATCTCATTATGGCTCCTACAGTAAGACTGTTACCATGCAAGAGTGTGTATAAATGATTGTGGCTGCCTTTATATTTTGGCTTGTATATTAAA
This mutation is a 499 bp deletion beginning at Chromosome 2 position 122,111,622 bp and ending after 122,112,120 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50154 | TGT TGG TTG CAT GTT GAG AC | Common | A | |||
| 50155 | AAC AAG CCG ATG CAC AGT TC | Wild type Reverse | A | |||
| 50156 | AGG CAG CCA CAA TCA TTT ATA C | Mutant Reverse | A | |||
| 50157 | Fluorophore-1 | TCT GTA ACA GGA TGG TAA GCA GCA | Quencher-1 | WT Probe | ||
| 50158 | Fluorophore-2 | TTT ATG CAG TTA GAT CTC ATT ATG GCT CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50154 | 0.40 uM |
| 50155 | 0.40 uM |
| 50156 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.