For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:104266648+104266750 103bp AAGATGCAGCAGGTGGAAAC CCTAACCAGGTCTGGGTCCT
Mut = 107 bp
Wt = 103 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
ATTCAGAGTTCTGTGTCTTCCAAGGGGTTTCTAATCATTATAAAACTACTAAGGGACACTGTGCTGTTGAAGGTATATTGACAGctgtcaggactcagcagtgggtgccatatagcatggaggtgcgctctctgtgctagtgttacaatctgatgatttgctccacatttaggcaaatggaagatgccctttgacccccgtgatacatttaattccaagttttacttggatgagaagaggtctgtgaaggtgccaatgatgaaaatagaggaactaactacaccctacttccgggatgatgagctgtcctgctctgtggtagagctgaagtacacaggaaatgccagtgccctgttcattctccctgaccagggcaagatgcagcaggtggaaaccagcttgcatccagagaccctgaggaagtggaagaactctctgaaacccaggtgcatacccacaggacccagacctggttaggattcccttagtgctgttgtcctgatatctagtatcccagtacctcagagtctcacttacagcctgtgtaattgttaaagtgtcagcaggggacaggtgaagttgaattgagttccctccactgtctcaggtgtttcaggcctgattttactgtggtttttgttcttcacaatatgtgacaatctcacacagtgagatgaggtttttccccCTCTCTAATAGCCTGTAAATTATATGGAAATGATTGAGAGTTGTAAGCCACAGGGATTGTGATTAACAGGAGAT
This mutation is a 604 bp deletion beginning at Chromosome 12 position 104,266,357 bp and ending after 104,266,960 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50127 | AAG ATG CAG CAG GTG GAA AC | Wild type Forward | A | |||
| 50128 | CCT AAC CAG GTC TGG GTC CT | Wild type Reverse | A | |||
| 50129 | AAA ACT ACT AAG GGA CAC TGT GCT G | Mutant Forward | A | |||
| 50130 | AAT CAC AAT CCC TGT GGC TTA C | Mutant Reverse | A | |||
| 50131 | Fluorophore-1 | CCA GAG ACC CTG AGG AAG TGG | Quencher-1 | WT Probe | ||
| 50132 | Fluorophore-2 | TGA AGG TAT ATT GAC AGC TCT CTA ATA GCC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50127 | 0.40 uM |
| 50128 | 0.40 uM |
| 50129 | 0.40 uM |
| 50130 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.