For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:3223168+3223326 159bp GCATGCTGCTGTGAGAGACT GATGGCTGTTTTACCCAAGG
Mut = 159 bp
Wt = 159 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case;):
TATTTAGAATGCTGGGCATGCTGCTGTGAGAGACTAGCTTCTCCTCTAAggggaggggtgggaatccccttgatataagagcatttcatacctgagcatcaggggctaccagccactgaagggctagcgactgtcatggatgggagtgacggtaccttgggtaaaacagccatcgtgtctctgaccagccactctgtctcgcaggcaggaagagggttttgttttttgttttttaagtcattacattctcaactcattattcctattcttacatgaaggaattcaaagctctaaaatgcgattttctgaccttctaggtcccgttatgacacaggacattaccacgtatcacacggtgtttcttttggccattttaggaggaatggctttcattcttttggttttgctgtgtctccttttatattattgcaggtaaagtgttaccatttggatgatgtatttgtttaatgtagaatttcctatgcaaTTGGTATTCGGAAATGTTTTTTTCCTTCTTCTTTCTTTTTTCCCC
This mutation is a 438 bp deletion beginning at Chromosome 2 position 3,223,202 bp and ending after 3,223,639 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50094 | GCA TGC TGC TGT GAG AGA CT | Common | ||||
| 50095 | GAT GGC TGT TTT ACC CAA GG | Wild type Reverse | ||||
| 50096 | TAA CCT GTG GGG TCA TTT GC | Mutant Reverse | ||||
| 50097 | Fluorophore-1 | TGA GCA TCA GGG GCT ACC AG | Quencher-1 | WT Probe | ||
| 50098 | Fluorophore-2 | TCT CCT CTA ATT GGT ATT CGG AAA TGT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| Primer 1 | 0.40 uM |
| Primer 2 | 0.40 uM |
| Primer 3 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.