For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:137562951+137563119 169bp TGTGAAGTGTGTGTGTATAGGAATG CCCGAGTGTTCCACTGTGA
Mut = 190 bp
Wt = 169 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CGTATTTGTTCTGAGTATGGACAAATGTGTGTGTGCACACACACATACATACTAACTGACATgtgggctgggcctccatctggactcttctcctgtgctcttctcacagtggaacactcgggccaagcgggagaagctgacggagctgatgttcgagcagtacaacattcctgccttcttcttatgcaagacggccgtgctcacagcgtatcctacatctcgggcagtcctgctgggtggaaggctagagtggggtgtgtgttgagctgggtggggctgggcctgattccctggagatcagtatctcgggtaggaagaatcctcttagcacctcactagtgcagaaggccccataGGCTGGAGGCTTGGGCTAGGGGCGGAGGTTGCAGATCTGTGGCCCTTCCCTATTTTACTTAGTTTATGGGTCAGTCTCAGCAGGCAGA
This mutation is a 293 bp deletion beginning at Chromosome 5 position 137,563,060 bp and ending after 137,563,352 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49911 | TGT GAA GTG TGT GTG TAT AGG AAT G | Common | A | |||
| 49912 | CCC GAG TGT TCC ACT GTG A | Wild type Reverse | A | |||
| 49913 | GCT GAG ACT GAC CCA TAA ACT AAG | Mutant Reverse | A | |||
| 49914 | Fluorophore-1 | CTG GGC CTC CAT CTG GAC TCT | Quencher-1 | WT Probe | ||
| 49915 | Fluorophore-2 | CTG ACA TGG CTG GAG GCT TGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49911 | 0.40 uM |
| 49912 | 0.40 uM |
| 49913 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.