For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:86573821+86573925 105bp CGGTGGTTAGGAAAGCTGAC TAGTTTATCATGGCAACTGCAC
Mut = 93 bp
Wt = 105 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TGAGCATGGTCTCCCTCAGGAAGCTCCGGTCTGAGGCAGGAATCTTGTCTGACTTCATCACTTCCTGTTCCAGCACAGGACACCCAGCACACGTCGCTGGTCGGCGGTGGTTAGGAAAGCTGACTGCATACgttgttcagtggcaggcaggcccttgagagtctccatgactgttcctatcgtaatcgtgcagttgccatgataaactagctcgtgtgatttctcagtatttaaatctatgtcgtttttattttaaggtgaccattgatttgcaagtaaccatgcctcacaactacccatacgtggctctgcagctgtttggacggtcacctgagcttgacagacaacagcagctgctgcttaaccaagctctcagtgcttatctcgggactttcgacccaggtgagttgtgtgtctgtgcagccatccagtggctgcaggacaacagcgcatcctacttcctcaccagaaagctgtcggacgagccatccgtacaggcgaagccagtcaagaacacattcctccgcatgtggatctatagccaccacatatatcagcaggacctgaggaaaaagatcttggaagtgggaaaaaggttagatgtgactggattttgcatgacaggaaagcctggtataatctgtgtggagggcttcaagaatcactgtgaggaattctggcacacaatcagataccccaattggaaacacatttcctgcaagcatgcagaaagtgtggagacagagggggacggtgaagacctgcgcctcttccattcgtttgaggaattactccttgaggcccatggtgactatggattgcggaatgattatcacatgaacctgggccaattcctggagtttctgagaaaacacaagagtgagcatgtttttcagatattatttggtattgaaagcaaaagctcagagtcctagaaccctattaagatgtctacgcttgtaaccgcattaagtatttatgttactaagaccaaaataaaaaggctaatgacaatatagaattctgggtgaaaaacctagctctagaatttcctgactgctgatgctaataggccctttaactttgtaccagtgtaactgtgatgctgtttccaggttgctgtgtaaagtcacacttgattaccatttcattataaatcaataaaatgatatatttaaccagagcaacttgtctcaagtccaaaaccaggctggagaggtggctcagaagctaagagcaccactggctgctcttgcagaggacctgcacagcagctcgctgccatctgtaactctagttccagtggaatccatgccctcttctggattcttcaggtaccaggttcatatgcgctgcacagacatgtgcagggaaaacacccatacccacacacaataaataaatgaataaagcaagtcccgagccccacattaatgtctCATACCAGACTGCAGATACAAATTCATAAATTTAAGACATCTGTTTCATGACGCTGGCACATACGTGGCATACCCCCT
This mutation is a 1308 bp deletion beginning at Chromosome 9 position 86,573,848 bp and ending after 86,575,155 bp (GRCm38/mm10). There is an 8 bp (CGAGATAT) insertion at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49905 | CGG TGG TTA GGA AAG CTG AC | Common | A | |||
| 49906 | TAG TTT ATC ATG GCA ACT GCA C | Wild type Reverse | A | |||
| 49907 | GCC AGC GTC ATG AAA CAG A | Mutant Reverse | A | |||
| 49908 | Fluorophore-1 | CAG GCA GGC CCT TGA GAG TC | Quencher-1 | WT Probe | ||
| 49909 | Fluorophore-2 | CAT ATC TCG CAT ACC AGA CTG CAG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49905 | 0.40 uM |
| 49906 | 0.40 uM |
| 49907 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.