For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:63294927+63295029 103bp TTCTCAGCACAGAAGCCTGA ATATGGGTGGTGTCGCAGA
Mut = 103 bp
Wt = 103 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GTTGATTCCATAAAAATACATAGTATTTTTATGTTATTATGGTTTATTATTTTAGGCAGCTGCATGGTATTCCATCGTAGCATACATTGTAATGTAAGGTTATTGTTGTGGAGCCTCCAGgctttttgctatatggtatgataaacaaccttttgatgtcatccttaggaatgtatttagagaaatataacaactatatttaaagaagacatacttaaatggttttagatgcatatagtagaggtgatgtatggaaagactatcaacttatatttctacaaggaatacattcatgagtccatcttgtgttaccatgaataacattactcatttaaaatacctactggtttctctttatagcacttgtttagttctcagcacagaagcctgaccagacagagcagacgtcggacagctactaataacactctgatggaacgctttttgcaggatgttctgcgacaccacccatataattaccaagacaacaggtaagatagttcagtggaatgttaatatctctgtCAGTGGTATATTCCACCCACCTTTATCATCTTGATGTGTATCCCAGGACTGGTCTTGCCTGTAA
This mutation is a 405 bp deletion beginning at Chromosome 1 position 63,294,676 bp and ending after 63,295,080 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49702 | TTC TCA GCA CAG AAG CCT GA | Wild type Forward | A | |||
| 49703 | ATA TGG GTG GTG TCG CAG A | Wild type Reverse | A | |||
| 49704 | TGT AAT GTA AGG TTA TTG TTG TGG AG | Mutant Forward | A | |||
| 49705 | AAG CAT TTA CAG GCA AGA CCA | Mutant Reverse | A | |||
| 49706 | Fluorophore-1 | CAG AGC AGA CGT CGG ACA GC | Quencher-1 | WT Probe | ||
| 49707 | Fluorophore-2 | CTC CAG CAG TGG TAT ATT CCA CCC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49702 | 0.40 uM |
| 49703 | 0.40 uM |
| 49704 | 0.40 uM |
| 49705 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.