For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:30441687+30441778 92bp CATGTTTGAGCCTCTCAGGT AACTGGGGAGGAAGAAGCAC
Mut = 99 bp
Wt = 92 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AAGATGATAGATCATTTTTCCCGTTTTTCTGTGTTTTTGAGCTGTCTTGAACAGCAATGGTATTCTGTAGACTTGACATTGCAATGCACATTATTTTATTTAGTGAATTCTACAAGTGCATTTTGGCTGTGTATCATATATCTAACAGTgagccgtgtgagagagatccatctagtattaactaagacatttcttttgcaaagtcctatagttagatatgtgtgatcttagatcattaaagtagacatgtttgagcctctcaggtggtctgggctcatgggcaacatgctagagatagcagtgcacgagtggaatgtgtgcttcttcctccccagttgtgctgcatggaaacaacctgttagtgttcggaggtacaggcatcccgtttggtgagagcaacggcaatgacgtccatgtctgcaatgtgaagtacaagagatgggctctactcagctgtcgggggaagaggcccagccgtatatacggacaggtactgcctgctacggcaggtccacggctgtgcgCTTGCCTTGTGCTTGCCTCATGTTTTGTGCTCTAGCAGCAGTGTCAGAATCCAGTGTTGCTGTGGTTGCAGTGGAGATGGGACTTGATGGGGCATTTCACTTCCTGGTGTGAAAGTATAATTTATGGATCTTACATTCCCCCCTCTTCTTGTCACCATTCTGCGCTGTGTGTTGGGTTTGTTTTCCAAGTGTAGGCGAGAGGACAGCCTCAGGTATT
This mutation is a 365 bp deletion beginning at Chromosome 6 position 30,441,596 bp and ending after 30,441,960 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49340 | CAT GTT TGA GCC TCT CAG GT | Wild type Forward | A | |||
| 49341 | AAC TGG GGA GGA AGA AGC AC | Wild type Reverse | A | |||
| 49342 | CAA GTG CAT TTT GGC TGT GT | Mutant Forward | A | |||
| 49343 | CAG CAA CAC TGG ATT CTG ACA | Mutant Reverse | A | |||
| 49344 | Fluorophore-1 | TCT GGG CTC ATG GGC AAC | Quencher-1 | WT Probe | ||
| 49345 | Fluorophore-2 | ACA GTC TTG CCT TGT GCT TGC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49340 | 0.40 uM |
| 49341 | 0.40 uM |
| 49342 | 0.40 uM |
| 49343 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.