For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chrX:114522382+114522570 189bp TAGAAGGAGTAGATCCAAATGCAC GCTCCTTTAAGAAAGTGATTTAACTGC
Mut= 179 bp
Wt= 189 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TTGTTTTAAGCAAAGAGTTTACTACATAACCTAGTCTGGCCTGGAATTTGTTATATATACCAGCCTCACCTGGAACTCAGAGAATCTGCCTATATTGGCCTCACATGCCCTGGCATTAAAGGCATTTGCACACATGAGTGGCAATTTTAAACTTTTATGGAGAAAGTATACTGATAAGTTTTTAAAACATATTGAAAGCTCTGCACGATTATTTGTGATGCTGTTGACTAACAATACGTATggatttaaccttccaatttctagattggttctcagtgctgtgtctgattattttgctgcaatgtttactaatgatgtgcttgaagccagacaagaagaggtcaaaatagaaggagtagatccaaatgcacttaattctttagtgcagtatgcttatacaggtaagcccccaatGTATATTAACTAATGCTAACTCTACATTATATAGGATGTGTTTCAATGTGTAATAACTAATATTAATGCTACAAAAACAGAAAGTATAAAATATAGCAGTTAAATCACTTTCTTAAAGGAGCAAGAGAAAAAAGGACAAAATAATATATTAATCACCATAATACAAATTATAAAGAGTATGCTGTTGAATATTACTACCATGAAAGCAGAGAGCTATTTTAACATAAGAATACAAGAATGTATCCTGTATGG
This mutation is a 173 bp deletion beginning at Chromosome X position 114,522,276 bp and ending after 114,522,448 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48051 | GCT CCT TTA AGA AAG TGA TTT AAC TGC | Common | A | |||
| 49217 | TAG AAG GAG TAG ATC CAA ATG CAC | Wild type Forward | A | |||
| 49218 | AAA CAT ATT GAA AGC TCT GC | Mutant Forward | A | |||
| 49219 | Fluorophore-1 | AGT GCA GTA TGC TTA TAC AGG TAA GCC C | Quencher-1 | WT Probe | ||
| 49220 | Fluorophore-2 | CGA TTA TTT GTG ATG CTG TTG ACT AAC A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48051 | 0.40 uM |
| 49217 | 0.40 uM |
| 49218 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.