For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:83934941+83935061 121bp TACAACAGGACTGGATTCAGCA AGTATCTAACATATTATCACGCTTGT
Mut= 136 bp
Wt= 121 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
ATGTTTTTATATTTGAGGTGTTATTTTTTTAATTTATGCTTTTCTTCAGGTCTAGATATATGTGCATTTCAAAATGAATGTTTTGATTCTTGATTCAAGAAATATTTATGCTAAATATTTTTTAAGTGGAATTAATATGGTATGGGGTTAAATGTATTTGTTTGGAGGACTTTAATTTTTGTTTGTATAAATTCTGTTATATCTAAATGCTATTTCAGATTAGATTTGTAAATTTCTCAAATATTCTTTGTTATTTAAAAAAAGCCTAATtgatttgtcagcttgagaattgttttaattcaaccttctttttttacaacaggactggattcagcatcaaaatacctccacccacattgagagctgtcggcagttaaggcaacagtaagaatagtttcttcccttcTTTACAAGCGTGATAATATGTTAGATACTTTAAAGCTATTGGTTATTTAAAATAATAATCTTAGAAAACTATGTTTAGTTTTCCAAAAGGAGAGCTTCATGTGATCTTTCACTGACTCCTTCTTAACTTAATCTCTAGTAGGTAATTATAGACTTTTTTTTTTTTTTTTTGTGTCTCGTTTGCCTTTTCCAGAATGGTTGAGGACAGATAGCATTCTTTTCTATTATCTTGGGCCATTTCTCAAAGGTTGCATAATTAAAAACTAACTCAGACCATATGCCAGCATTTAATTTCCATTATAAAGACTTTCC
This mutation is a 136 bp deletion beginning at Chromosome 6 position 83,934,897 bp and ending after 83,935,032 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47486 | TAC AAC AGG ACT GGA TTC AGC A | Wild type Forward | A | |||
| 47487 | AGT ATC TAA CAT ATT ATC ACG CTT GT | Common | A | |||
| 47488 | GGA GGA CTT TAA TTT TTG TTT GT | Mutant Forward | A | |||
| 47492 | Fluorophore-1 | ATG CTA TTT CAG ATT AGA TTT GTA AAT TTC TC | Quencher-1 | MUT Probe | ||
| 49149 | Fluorophore-2 | TGT CGG CAG TTA AGG CAA C | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47486 | 0.40 uM |
| 47487 | 0.40 uM |
| 47488 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.