For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 104 bp
Wild Type = 129 bp
>chr16:32891568+32891696 129bp GTCTGTGCCTTTTAAATGTTGG TGTGGACGCACACTTACAAA
Sequence
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion): TTCAAGACCATACAGGACTATGTAGTGAGACCCGTTTCAAAAACAAATAAAATAGTGGCTACTGTATTGCACAAGTACAGTTTAGATTGTCCTGTTGAGAAATTAATGTTAGGGGTTTGAGATACATTTCAGTAGTAGAGTGTTTATGTAGCACGGTAAGACCCTGAGTTTAATCATCACCATATGCACcaccttagttaaaaaggaaagtatcttggcatttctaaatttttaatatcctttccttctgtaggttttggtaaaactagtttgagccgtagaggaagagtattgcctggaaaaagacgtccttatggagttatcaccggccttgcagccaggaaagcaactgggattcgaaaaggaataagtcctatgaatcgtccacctctaagtgacaaggtaggatgtcatatgatgacttagtcctgaccctgataccattttccatttatactgtgtctgtcacacgtttattactgaattttaagatagacagtcctttctggcctacagaacttattgtatagaccatgctggccttgaattcacagaggtctgtgccttttaaatgttggaattaaagacatgtaccaccacacctggctatcctaaggtttttatgaataagctttagagcgtattttgatagatgtagggTTTTATTTGTAAGTGTGCGTCCACACTTGCGTGAGTGCAGGTGGCCTTGGCTGTCAGATTCCCGCTACCTCTGCAAGAACATCTAGTCCTGTTATTTGCGGAGTTGTCTCTAGCCTCTTACCCCCTTTAATATATTAGA
Mutation details
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49146 | GTC TGT GCC TTT TAA ATG TTG G | Wild type Forward | A | |||
| 49147 | TGT GGA CGC ACA CTT ACA AA | Common | A | |||
| 49148 | AGG GGT TTG AGA TAC ATT TCA GTA G | Mutant Forward | A | |||
| 49150 | Fluorophore-1 | ATG TAG CAC GGT AAG ACC CTG AGT | Quencher-1 | MUT Probe | ||
| 49151 | Fluorophore-2 | ACA TGT ACC ACC ACA CCT GGC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49146 | 0.40 uM |
| 49147 | 0.40 uM |
| 49148 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.