For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr13:59595196+59595296 101bp TGCAAGCATAATTGAAAGCA TCCAGACTAAAAGGAAACATGC
Mut= 87 bp
Wt= 101 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
CCGCTCGCCCCCGCCCATAGGATTTTTTGTTTGTTTGTTTCTCATTACCTACCGTTGTGAGCTACCATGTTGCTGGGAATTGAACTCATGACCTCTGGAAGAGCAGTCAGTGCACTTAACTGCTGAGCCATCTCTCCATCCCCAAAAAATGATTTTTAAATTTTTAATTCTTACTGGAATATTAAGATAACCATCTTAATTTGCTTGTTAGTTTTCAGTTCTGTGGTTTTATATTCTTTTTTCTTtctTTTTTTTTTTTTTTGATCCATTTCATAATGCAAGCATAATTGAAAGCATCactgtggtaattgagtatctagtcaatccttagaaaatgatttttaaattaatccaagcatgtttccttttagtctggaaacttaaactttattgcgctattaaagtaacttttctctctgattcttttagagctgaagttgggagaactgcttcatgataagctgtgagtatttgtggtgtagtagttgtggaaaactttaatctttttttttcaggtagaatattctttgaagtccaagtaaatttatgtttcaaatgagttgtacaatttctatttcagtttgggtgagctatcttgagtcacTGACATGGTTAAGATGTGAAACGCCAAACTGTTAGGATACTTTTCACGAAGATGGACATGCTGAACATGTGATTTTTGAAGACAGCTATTAGTTGTATGTCTAGTATGGTAGATTTATCAATGACTGATGCTGGTGTGGAATAAAATTGAATATCTCCAAGTGAACCAAAGGAAAGGAAATCCTGGCCTATATTTATACCTCGCTGTGCTGCTGCAGACACACTGTGGCCAGGC
This mutation is a 306 bp deletion beginning at Chromosome 13 position 59,595,218 bp and ending after 59,595,523 bp (GRCm38/mm10). In addition, there is a 3 bp intronic deletion (TCT) 41 bp before the larger deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48068 | TGC AAG CAT AAT TGA AAG CA | Common | A | Common | ||
| 48069 | TCC AGA CTA AAA GGA AAC ATG C | Wild type Reverse | A | Wt R | ||
| 48071 | Fluorophore-1 | ACT GTG GTA ATT GAG TAT CTA GTC AAT CC | Quencher-1 | WT Probe | ||
| 48072 | Fluorophore-2 | TGA AAC GCC AAA CTG TTA GGA | Quencher-2 | MUT Probe | ||
| 49050 | ATG TTC AGC ATG TCC ATC GT | Mutant Reverse | A | Mut R |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48068 | 0.40 uM |
| 48069 | 0.40 uM |
| 49050 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.