For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:116415471-116415605 135bp CCTAAGACTCAAAACCTGAACTC CTGCAAGACAAGAACATCACC
Mut= 135 bp
Wt= 135 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CATCTGTGATGCTAAGCTCTCAGAACCTGCTATGGCTGCCGGCTAGTGGGTAGGGGTTAAGTGGAAGGCTGGAAGTTAGGGAGCAGGTGTCCCAGTTTAACATTGAATTGCCATCAAACTGGCCAAAGTCCTCTTTCCTGCCTATCAGATTAGCTCATCTTCAGCTAGCTTGGGAGGTGGGCTTGAGTCTCTACTCCAAAGTCCTAAGACTCAAAACCTGAACTCCGAATCACCCCCTAGCTACGCAAGACAGGAGCAGATTTGACTCCAAGCCCATATCCGGAATGGTGCCcaggggatgcagattctaacatacggtgatgttcttgtcttgcaggcaaacatgaagagaagcagcaggaaggtgggattgtctccaagaacttcaccaagaaaatacagtaagtagccttgtgggcaggtggactgtgggcaagcattgcaattgtgagtacaacccaactttcttgggagacacgcctgggcaaggaattgaactctcataccaAAAGGGAAGAAGCTGTCATAGTAAACTTTCAATGGGGGACCCTAAGTAGGGGGTTAGATTGTCACCTCATCAGCTCAGTGCCCTGTGAGGAGGGCATCAACCCCATCAGGAAATAGAGAGGCAAAAATGACTCATGCATCTTACACTGAGAAGTAAGTGGATGTAGTGCTCATCGTCCCAGGAGGATAGACAGGAGAGGGTATCGCCATCAAAGTAAGCCCCACGCATCTCTAGCCTCCTAGTTGCTGTGATAGGACCCTGTGTGTGTGTGTGTGTGTGTGTG
This mutation is a 216 bp deletion beginning at Chromosome 5 position 116,415,300 bp and ending after 116,415,515 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47996 | CCT AAG ACT CAA AAC CTG AAC TC | Common | A | |||
| 47997 | CTG CAA GAC AAG AAC ATC ACC | Wild type Reverse | A | |||
| 47999 | Fluorophore-1 | CAG GGG ATG CAG ATT CTA ACA TAC | Quencher-1 | WT Probe | ||
| 49039 | TTA GGG TCC CCC ATT GAA AG | Mutant Reverse | A | |||
| 49040 | Fluorophore-2 | TGG TGC CAA AGG GAA GAA G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47996 | 0.40 uM |
| 47997 | 0.40 uM |
| 49039 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.