For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:106733028+106733143 116bp ACAGAATGCCCCCAGAAAAG CCTGTGATTCTTGGTCTCTGA
Mut= 124 bp
Wt= 116 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TTGCCTCCTTTGGTTCAGCAAAAGATACTTGGAACTGCAACCACAAGTACCTCAGGAACAGTTGAGGCCTCCCAAATACCAACAGTTGTTTATGTACATCCTGTAAATTCAGTGAAATTTGTTGTTACCAAGAAAACTCAGACTATTTACCCCAAACCAGTGACATTCAATACCTTGCAAATTCCACCAAATGTTGCTACAGAAACACAATTAAAAGGTGGTCAGCATCCTCAAGCTGCTCCAGTGAACTCGatttttcaggagtatctacagcctggaatcccatgtattattcctgttaagtcttcaaataatgtggctacaaaggttttaaacacttttgtaggtaggaaaaatctgggagataatacaatagatacacctctgttgaataccaacagttctggcaggacacactccgtaagtgaacctattaaagataatgctttgataatgtttaatgggaaagtctggttgaatgaaaaggggacatgcggtctgccatcaaaaattgaccagcagaattctgtttcttctgatattccactaaaagattcatcacagctagtaagttcaagtatagtcacagaaatatccagagagattttaaatagtgttttggttaaaagtaaatcttttcagttgaagacaaaatcactttcaaattcccagcttgcttccatggccaatctaagagcagagaagaatgaaaaagtggagagaccatctttttctgtcacaaatccacatactatgaaccagtccactcactgccttaaacagagtaagactgtatttataaacccagtttttccagatggatttaggacaggacagaatgcccccagaaaaggaaatctcgtccagaacatagagaaaatatgttcctctgttgATGCAGCAACTGTTACTTCTCAACAGTGTGTTTTCAGAGACCAAGAATCACAGGTAATTTTCCCACATCAGGATGCTCTTTATATATATATATATATGTGGAAACTATTTCTTAATTCTCAAAATTATCTGATACCTGTCTCCTACACACACACCCCATCACAAGGCTTGCTTAAAATTTTTATCTGAATAAATATTTGTGTACAAGTAGTAGAGCCTAAGCAATATCTTTCTCTTTCAT
This mutation is a 643 bp deletion beginning at Chromosome 3 position 106,732,447 bp and ending after 106,733,089 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49000 | ACA GAA TGC CCC CAG AAA AG | Wild type Forward | A | |||
| 49001 | CCT GTG ATT CTT GGT CTC TGA | Common | A | |||
| 49002 | TCC ACC AAA TGT TGC TAC AGA | Mutant Forward | A | |||
| 49003 | Fluorophore-1 | CCA GAA CAT AGA GAA AAT ATG TTC CTC | Quencher-1 | WT Probe | ||
| 49004 | Fluorophore-2 | CCA GTG AAC TCG ATG CAG C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49000 | 0.40 uM |
| 49001 | 0.40 uM |
| 49002 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.