For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:46245331+46245434 104bp ATGTCTTCGTGGGAAAGACG GGCTCTCTGTAGGCCACACT
Mut = 113 bp
Wt = 104 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TGGGAGGAGGGTGGCAAGTGTCCCCTCTGCTCCTTCCCATTCCCCATGGGGACACCGGATTCCTGGGGCTAGGTAAGAATTTCTGGGGAGATCCCAGGATCCAGGGGCCAAAGTGGGGCAAGAACACAGAAAACTGGAAAATGATGGGTCAAGGCTTTCTCATGACGCAAGAAGGAGATGGTTTGAGGTCTGGCGAGCACgaagtcaggcttcacgtaccaaggaggggtggcaagcttggctggacctgccttttcttgagagacctctgctgggagccaggcttcatcttcggcatgtttaggtgtagaggaaagaggacgtggagccagatagcccagtgcacagaactaattgttctctgttcctaaaaggaggctgaagccttagccgcatcggccatgtcttcgtgggaaagacggctccatcgcgccaagtgtgcaccgtcgtgtaagttgcgccctctctgtggctatgcgtaggagagtgtggcctacagagagcctgccagggtaccacttgtgagccccttccggtgcctggagtctcttcctaccttccccagcttgatttgcatagcctcaccgtatcctggtcacatccttgtgtcccggctcctgctcacattgtctgattcgtgagtttgctgcctcacaagatggctgactcctcctccgacctcatactctttctggtcttgcttcctacttccagtgggatGATCCTTCAGTGTGCTAATTCCTGTGGTTAATTCTCTCTTTACCTCCCTTAGATCTAAGGCCTTCTCATCCCCCTTTTTCTGTCTGTGACCTAGTCCCATGTCCTGTGTCTGTGCGGGCCCCCATCAGAGTCCCATGTCTGTCCTGTCCGTGAC
This mutation is a 520 bp deletion beginning at Chromosome 7 position 46,245,130 bp and ending after 46,245,649 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48921 | ATG TCT TCG TGG GAA AGA CG | Wild type Forward | A | |||
| 48922 | GGC TCT CTG TAG GCC ACA CT | Wild type Reverse | A | |||
| 48923 | GGA GAT GGT TTG AGG TCT GG | Mutant Forward | A | |||
| 48924 | CAG ACA GAA AAA GGG GGA TG | Mutant Reverse | A | |||
| 48925 | Fluorophore-1 | TCG TGT AAG TTG CGC CCT | Quencher-1 | WT Probe | ||
| 48926 | Fluorophore-2 | CAC GAT CCT TCA GTG TGC TAA TT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48921 | 0.40 uM |
| 48922 | 0.40 uM |
| 48923 | 0.40 uM |
| 48924 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.