For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:12077432-12077550 119bp TGCCTTTCAAGCAAATGATG TCCACTGTGCAAGATATAAAGGAGT
Mut = 138 bp
Wt = 119 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
ACTTCAGTGAATGGTGTTATGTACTGGTACATGTACGTTTATAGGTTTGGTGTCTAAAAATAAAATTTAGTGTTGTGTGGGGAATATGGATTTGGAGGCTATTAGAAGCCCTCACAATTTTGACAACCTGCCAGCAATCTGTGAAGACACTCTCCTCATCCCAGCATGTAAGGAAAGATGTTGAGAAATTTGGCttagggaaaatgttggtttgctgttatagtcacttagaaaactagttctatgtgttttcagttggaatggagaagattttttttggtatattttattatatatatgcttggcatgcctttcaagcaaatgatgctactttgagaattattattacactgataattacagggacatgtgaatatttcagagtatataatacaacactcactcctttatatcttgcacagtggaaagaaatgttagtgggtctttgttagcccaagcaacttgcgagctttgtgatgaaagtgaaaactcatttacaaaagccaatgctttaggaaccaggtgagtagtgtactgaaaacaaaattcattgatgtcctacttttatgtgccatctgtgtatcccaagaaaaaatacaggtagtcattaaaggggcTGAGATTCAGAATCCATGAAAACGTGGGCTCAAGTCTTAAATTAGCTTTCTAATAATTTGGTGTTAGATAGTTAGAATCTCCTGTATTTAGAACGGAAGTACACTCTCCATTGCATAGGTTTCATAAGCTTCT
This mutation is a 423 bp deletion beginning at Chromosome 4 position 12,077,241 bp and ending after 12,077,663 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48910 | TGC CTT TCA AGC AAA TGA TG | Wild type Forward | A | |||
| 48911 | TCC ACT GTG CAA GAT ATA AAG GAG T | Wild type Reverse | A | |||
| 48912 | AGC ATG TAA GGA AAG ATG TTG AG | Mutant Forward | A | |||
| 48913 | GAG TGT ACT TCC GTT CTA AAT ACA GG | Mutant Reverse | A | |||
| 48914 | Fluorophore-1 | CAC TGA TAA TTA CAG GGA CAT GTG A | Quencher-1 | WT Probe | ||
| 48915 | Fluorophore-2 | TTG GCT GAG ATT CAG AAT CCA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48910 | 0.40 uM |
| 48911 | 0.40 uM |
| 48912 | 0.40 uM |
| 48913 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.