For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr14:56912825+56912982 158bp GTGATTTCCTGGATCTAAAAATGG AACAATGGTTCCCTTCATTG
Mut= 168 bp
Wt= 158 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case; and insertion with carrots ^g^ (GCATGATT insertion):
TTATAGATATGAGCCACCATGCTTGGCAAGTGGTGCATTTAAGTAGACTATTTTGTGTAGTAATCTCGTTTACCTATTAATCAGTTGGGAAGGGGAATTGAACAGGCAGTGTCAGTTTAAATAAATAATTATTCTTTTATTCCATGTTGTTATAGAAATTTTATTTTAATGTTTCCAATATCTGAAAGCCATGTTAATGTATTTGAAGATAAATTAATTTTGACTTTTAATCTTTTCTGAGAGTTCATATTTTATACTAAAAGTGATTTCCTGGATCTAAAAATGGTGTTTGATTTCCATGAT^ctaatctgtggttaaaatatcagttataacctttatttttggtttcttatgaaatggagctttaagttgtacctcttgtttttcagagatataactacaatgaagggaaccattgttgctcaagtggactcaagtgagtccttccaagaattttgtagtacatcttgtttgtctctctatgaggacaaacagagtcctgctaaaggagctctaaataaatcaagatgcacaatctgtggcaaattaactgaggtttgtacttctgtacttttcatttacttgtatgagaaaagagttcagattttaacagttttcctgtac^TCTATATTGATGCATGTATTCTCAGAATGATGATATGCAAGACTAGGATTCATAAGACTAGAATTGTATAATTCACCCAAAAGAGTAAGTAGTATTATGATTGCTCTTTTTGGTTGTTGTTTTTTGTTTTTTGTTTTTCGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTTCTGGAACTCACTTTGTAGACCAGGCTGGCCTCAAACTCAGAAATCTGCCTGCCTCTGCCTAGGATCAAAGGCGTGCGCCACCACACCCGGCTTGCTTTTTCTTTTTTATTGGTCTAATAATATGTTTATTTATACAAATAGACTGACTATACAAGAAA
This mutation is a 321 bp deletion beginning at Chromosome 14 position 56,912,866 bp and ending after 56,913,186 bp (GRCm38/mm10). In addition, there is an 8 bp insertion (GCATGATT) at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48699 | GTG ATT TCC TGG ATC TAA AAA TGG | Common | A | |||
| 48700 | AAC AAT GGT TCC CTT CAT TG | Wild type Reverse | A | |||
| 48701 | CAA CAA CCA AAA AGA GCA ATC | Mutant Reverse | A | |||
| 48702 | Fluorophore-1 | ATG AAA TGG AGC TTT AAG TTG TAC CTC | Quencher-1 | WT Probe | ||
| 48703 | Fluorophore-2 | ATG CAT GAT TTC TAT ATT GAT GCA TGT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48699 | 0.40 uM |
| 48700 | 0.40 uM |
| 48701 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.