For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:47075162+47075306 145bp AGGAGCAAACTGACAACAATG CCCAAATCCTCACATATACCA
Mut= 125 bp
Wt= 145 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AGTGTTGGGATTAAAGAAAGACGTGCACCACCATGGGTCAAAGATGGTTTTCAAAAGAAATACATACTGGTAGTGAGTCTTAGGTCTGCTCAGAAGCCCCATTCACTGCATAATTCCAGAAGGTTCTCCTGAAGTGCTTATCATACGTTTCAGTAGAGAAATGGGTGGCTTTAGAAACTGAGTTATAATCATTTTGAAATATATTACTATTGATCCTACAgcctagtcagggttatttatatagttccattattacaaatatataattatatgctagctaccgatgattctgggatggtttataaatgtatgagggagaagctgattaccttaatgacacattgaaaaatgactctttaaaaatcactaaaacaggttccatggagatcaggaatgttactaccaggatgacctacgagtgttatctagtcttaccaaaaaggagcacatgaaagggaacgagaccatgctggactttcggacgagtaaattcgttctccgcatttcccgggactcgtaccagctcttgaagcggcatctccaggagaagcagaacaatcagatctggaacatcgtgcaggagcacctctacatcgacatcttcgacgggatgcctcgcagtaagcaacagatcgacgccatggtgggcagcctggcaggagaggcgaaacgagaggcgaacaaatcgaaggtacgggagctaacctagaatgatgtaatgtgcaggagcaaactgacaacaatgtcatgtgagtttccattatataatggaaattatgtatacattcttataactaccttggGAGGAATCCAGTACTGCATTTAAAATGTGTTGTTCTGAAGATTTGTGGTATATGTGAGGATTTGGGAATGGTTTCGAGTAACAGAGCCTTAACTGCAGAGGCTAAGACGAGCAAGGTTTGTTTGTTTTTTTTTTTTTTTTTTTTGCTTTTGCTTTTGCTTCTGAGACCCGCATAATAATTCCAAAGTGCAGTCTATACCTCTTGGCTTGTGGCTCCT
This mutation is a 583 bp deletion beginning at Chromosome 19 position 47,074,658 bp and ending after 47,075,240 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48689 | AGG AGC AAA CTG ACA ACA ATG | Wild type Forward | A | |||
| 48690 | CCC AAA TCC TCA CAT ATA CCA | Common | A | |||
| 48691 | TGG GTG GCT TTA GAA ACT GA | Mutant Forward | A | |||
| 48692 | Fluorophore-1 | CAT GTG AGT TTC CAT TAT ATA ATG GAA A | Quencher-1 | WT Probe | ||
| 48693 | Fluorophore-2 | CTA TTG ATC CTA CAG AGG AAT CCA GT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48689 | 0.40 uM |
| 48690 | 0.40 uM |
| 48691 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.