For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:67263908+67264042 135bp ATGGGATTAAGACTAACACAAAGC CCATCTCAACCCAAGACATCTAGT
Mut= 133 bp
Wt= 135 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case; and insertion with carrots ^g^ (A insertion):
TTCTATGCCAACTGTTGCAACGATTTTACACTTCTCTTTTTAACGGATTATTTAATCCAGACCTAATATCTGATGCTTTATTCAGTTCTGAGTCCTGACTATGTGGGTTTGAGATTTTTCTAAGAATAGACATTATAATTCTCTTGAGAGCCATTAGTCATTATTTAAAGTTGTTTTAAAGTAGATGGAGCCATTATTATAAATGTTGAAATAGCACAGAAAGTTTTACTGTCTCGATTTTTTTCTGAAAGTGTTTCTCATGCTTTCCATA^gcatatgtgtgagcaagtggttaagtaacgtgagtttccacttactgatctgcaaaagcaaatattacaagatggtgttacaatattcttcataggattatagtgcataatttgtccttaacatagtttttgggcttagggtaccataatttttttttttttaatctagcaattcatgatgaccaataaattggacacagcaatgtggctttctcgcctgttcacagtttattgctccgctctgttcgttctgcctcttcttgggtatgtattatcttgtttctgactcagaggtgttcggtcagtatctatgactgctttttagctttagaattgttcaattgtaaatgggattaagactaacacaaagcccacttaacagcaacagtaatctggtaataccaattaggatgttttatttctagtttgtgtgactgctcgttgaaaagctga^GGAAAACTAGATGTCTTGGGTTGAGATGGATTCTGCAGGTCTTTTAAGTTGACAAAAGTATGACTGCTTTATACTAATCAGTTGGATGTGTATGTGAAGAGATGTTTCCCAGAGTGTGGAGTACATTTGTGTAATTTGTTTTCTATTGACAATTAAATGATTTAGGTGTTGTGCAATTATGATGCAATTCACAAAGGAGGAAGAGACGTGGTAGCTGTTGAAGTCTCAGAATAACTTTTCCTCTGGTAATTTGCAGGTTGCATGAAGCAGCGAGCTTTTACCAGCGTG
This mutation is a 453 bp deletion beginning at Chromosome 5 position 67,263,561 bp and ending after 67,264,013 bp (GRCm38/mm10). In addition, there is a single bp (A) insert at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47830 | ATG GGA TTA AGA CTA ACA CAA AGC | Wild type Forward | A | Wt F | ||
| 47831 | CCA TCT CAA CCC AAG ACA TCT AGT | Common | A | Common | ||
| 47832 | AGT TGT TTT AAA GTA GAT GGA GCC A | Mutant Forward | A | Mut F | ||
| 47833 | Fluorophore-1 | AGT TTG TGT GAC TGC TCG TTG A | Quencher-1 | WT Probe | ||
| 48566 | Fluorophore-2 | AGT GTT TCT CAT GCT TTC CAT AAG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47830 | 0.40 uM |
| 47831 | 0.40 uM |
| 47832 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.