For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:37607544-37607682 139bp AGCTTTGATCCAGCAGAATG TTGGGGAGACCATAACAATTTC
Mut= 132 bp
Wt= 139 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CATCTTACTTTTGGAGTTAGTAATTTTTCATGGTGGAAAGTTAAAGAAAACTATCTTTGGATAGAAATATTGCTTGTCTATATGAACTGTTTATATAATGTGTCTCTTTTGAAAACTCTCCCTTCTTTTTCACTTTTCCAAACTTCCGGATCCCTTAGTATATATTTTATATACTTTTTTACATTTGCCAGTGCACATTTAAGTCCATTTATTTAAAATACTGACATTTGTTCTGTGTCTTCCACTTTCTTATGAGTTTTATGAACACAGAAGTTATGAAGGTGTTTGGTGCTTTTGTAAATAAAACTAAGGGCTCATTCAGTGTTAGACTGATCATCATATTTTAATAATTACTTATGTCTACAGcactaggctatttagtgtcagcaagattttcaactgtcagtaaagaaactctgatttgaaacaagaaacttgtgtttctgcattgttcttggttcactttaatgaacacaaaataagtataaaattatttttgttatttagaaaccagctttgatccagcagaatggggggctaaggtagaggaccgcttctataacaaccacgcattcaaggtatagtcttatgaacctaccagatttagCTATATTTTTCTATCTATAAAAGAAATTGTTATGGTCTCCCCAAGTTTTGAGAAGTGTGTCAAGCATTAAATAACTTATTAAAAATTTTTATGATGAGAAATACTCTTCTAGAATATATGAATTGAGTACCAATACTTAGCATTAATTTAAAAATGACAACAGGAGAAAGGACTTGATCATCACGCAATTAGTCCCATCTCTTATTCTTTAAACTTGGGTATCATAAGTCATAAATTATATCTCACAAAATAGAACGCTATTAGTCCAATTTTTTTCATTTGCATGTTACAAAAAGACTAATTCAAATAGAAGATAATGATAGGGATTTTTTTTCTTCAAAGTTAATCTCTTTAGTAACTGA
This mutation is a 241 bp deletion beginning at Chromosome 9 position 37,607,588 bp and ending after 37,607,828 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48249 | AGC TTT GAT CCA GCA GAA TG | Wild type Forward | A | Wt F | ||
| 48250 | TTG GGG AGA CCA TAA CAA TTT C | Common | A | Common | ||
| 48251 | AAG GTG TTT GGT GCT TTT GT | Mutant Forward | A | Mut F | ||
| 48252 | Fluorophore-1 | AGG TAG AGG ACC GCT TCT ATA ACA AC | Quencher-1 | WT Probe | ||
| 48253 | Fluorophore-2 | AGG GCT CAT TCA GTG TTA GAC TGA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48249 | 0.40 uM |
| 48250 | 0.40 uM |
| 48251 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.