For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:30608693+30608809 117bp TTGCATGACTTTCTGCTTAGGT ATGGGATGCCTTTCAAGACT
Mut= 107 bp
Wt= 117 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GCTATGTTGCTCAGACATCTTGAATCTGCAGTCTCCCTGCCCCCCCTCCAGAGTAGTTAGGGTTATAGAGCTGTGCCGTTACGCCTTGCTTGGTTCTAGGTTTTAAACATTTAACAGAGTTAAATACTAAAACTCAGGCCAATTTTTACATATTACCACCACCTCCCGTTACATGCTCCTAGATTTCATTGGTTTTTGAAGATCCTTCTTTCTCAGCTTTTCTGTTTACCTCTGATTTGCATGACTTTCTGCTTAGGTTTGTATTTTATATATTCTTCTTGCTGATCACCTTTCactgttacgattgatttctttgcttctagtgttttcagtagtcttgaaaggcatcccatttgtttttgttacttagaagttgtaccatcttctgcaaacaaaaaccagtactgttggtactcttaaaaaccttcaaactttatgattttagcaagtaaaacaggattttttttttcctaatatgatatcattgctcttaatatcttcctaatataaatgttattgtttttttaggggaaaggccatataaatgtgaactgtgtgataaaggatttgctcagaaatgccagctggtcttccatagtcgcatgcatcatggtgaggaaaaaccctataaatgtgatgtgtgcaatttacagtttgcaacttctagcaacctcaagattcatgcaaggtaaaaggaaatgagtcgtttgacctttatGTTAGTTAATGATTACAATCTAATGAGCAGTGCATTTTCTGTGAGCACACAGAGAGAGCACGCAGGGTAAGCCTCACAGGACAGTGTGCTGACTGTGGAACAAGAGAGTTGGATGCTTGTCCACCAGGTGTCCATCTGGGTCTCATCTTCCTTACATTTTCATTCCTCTCCTTTGGAATGGAAATTGTATTGTGCAATTTGTGTAAACTGTGTTTTGATTTTTATAAGAGTTGCCCACATCTCTGAGACTTTAGACCTGGAC
This mutation is a 424 bp deletion beginning at Chromosome 3 position 30,608,751 bp and ending after 30,609,174 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48211 | TTG CAT GAC TTT CTG CTT AGG T | Common | A | |||
| 48212 | ATG GGA TGC CTT TCA AGA CT | Wild type Reverse | A | |||
| 48213 | TGT GCT CAC AGA AAA TGC ACT | Mutant Reverse | A | |||
| 48214 | Fluorophore-1 | CTG TTA CGA TTG ATT TCT TTG CTT C | Quencher-1 | WT Probe | ||
| 48215 | Fluorophore-2 | CTG ATC ACC TTT CGT TAG TTA ATG ATT A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48211 | 0.40 uM |
| 48212 | 0.40 uM |
| 48213 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.