For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:74482088-74482191 104bp AAGCAGCCAGCAGAGAGAAC TGCAGCTTTGCTTCTTTTGA
Mutant= 120 bp
Wild Type = 104 bp
Sequence
Wt Sequence deletions in lower case t insertion in <t>:
CATACTTTCATGGAACAATGTAGCCTTTCTTCTCCCCTTTATCCTGAGTTTGTTGTCCCCTTAATTCCTTAATATCCTGCCCATTAAATGAATTAGACACCCTGTATCAAGTTAATACTTCC<t>cagtggcaatgatggtattagtgctcctatttcccagtaggaatttactctaagctgtatgtgtttccactgcagtgaggcctcagccaaggccctgtgggaagccttactgaactccaagcacaaagaggcagtgatggaagttcggagacatctagtggaagcagccagcagagagaacctgcccatcaagatgagtatgggtaagcccctgcctctgCGGAGGCAGCCCAGAAATCCTGTTTTCAAAAGAAGCAAAGCTGCAGCTTTGATATTGCCCTGGTGTCTGTCTATTCATTCCG
This mutation is a 220 bp deletion beginning at Chromosome 5 position 74,482,133 bp and ending after 74,482,352 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46663 | AAG CAG CCA GCA GAG AGA AC | Wild type Forward | A | |||
| 46664 | TGC AGC TTT GCT TCT TTT GA | Common | A | |||
| 46665 | GTT TGT TGT CCC CTT AAT TCC | Mutant Forward | A | |||
| 46666 | Fluorophore-1 | CCC ATC AAG ATG AGT ATG GGT AA | Quencher-1 | WT Probe | ||
| 48173 | Fluorophore-2 | TAA TAC TTC CTC GGA GGC AGC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46663 | 0.40 uM |
| 46664 | 0.40 uM |
| 46665 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.