For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:103096477-103096601 125bp CAGTACACAAGGTGAAGTTCTTTTG GTGCCGGTATACTAGAATTGATAGA
Mut= 97 bp
Wt= 125 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case; and insertion with carrots ^g^ (T insertion):
TGGCTCACAGCCATCTGTAATGGGATCTGATGCCCTCTTCTGGTGTGTCTGAAGAGATCAACAGTGAACTCACATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATCTTTAAAAAGTTTGCCATCATGCTGGCAGTTTCTATATGCATCTTGCCTCTTAATTACATTAACGGGCCATATCAAGTGACTGGCTATCCTATCTAGGTCTC^TTTCTGTAATGTACTGTATGTTATTCAAACAGTGACAAAAATATACTAACATCCTCAGATCGCATTGCCTCTgtatttactactaatacacaggcatgtgagcacaattttcaacagatatgtggctagttacatgtgaagtataacattttgaatcatttaagtttttgtgtttattttgtcctaagaccatgatacttagtatttttctgctgtactttttttgtttaccaagagttcgaaaccttgccctgtctagttattcactccatttaacaaccattgttttgcaggtgcttgattcaaaaggagttgatgtcacaccccgacctctctaccatccagatccacatgctgcgtcagcaaagccaaacaaactcttgacatcacaagaaggatcgcttggatcagattatatttcttcctatagcctctatcagaatacactaaaccctagcatgttagggcagtacacaaggtgaagttcttttgatttcactaattttgaacttccgtttggatTCATGCGTCCAGAATGTATATTAGTTTCCAGTTTTCTCACATCAATCTATCAATTCTAGTATACCGGCACTTACATTTTAATTATTCATGCTCAGAGCTTGATTAAATAGTTCCCATACATTCCAAAACAGGGTTTAAAGTTCACCTCTTGGTGAACAATTAATTGAAACCAGGAAAGTGAGAAGATGATAGAGTGAAGGATGCTCATTTGTTTACAATTTG
This mutation is a 450 bp deletion beginning at Chromosome 4 position 103,096,547 bp and ending after 103,096,996 bp (GRCm38/mm10). In addition, there is a single bp (T) insertion 73 bp before the deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48158 | CAG TAC ACA AGG TGA AGT TCT TTT G | Wild type Forward | A | Wt F | ||
| 48159 | GTG CCG GTA TAC TAG AAT TGA TAG A | Common | A | Common | ||
| 48160 | CTA ACA TCC TCA GAT CGC AT | Mutant Forward | A | Mut F | ||
| 48161 | Fluorophore-1 | CAC TAA TTT TGA ACT TCC GTT TGG | Quencher-1 | WT Probe | ||
| 48162 | Fluorophore-2 | CCT CTT CAT GCG TCC AGA AT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48158 | 0.40 uM |
| 48159 | 0.40 uM |
| 48160 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.