For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:34426472+34426583 112bp CGATCCATCAGTACCTTTCTTG GCTGCATATTATCTCCCTACCA
Mut= 112 bp
Wt= 112 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
ATCTCTGCTGGGATTGGGGCTTGTCACTTTCTAATTCAGTCATTGGATTAGCACCTAGGGTCAATTCTCAGGCACCTTTTACTCTTATTTGTGAGTTATAATACCTTCCTCAGAGATGGACTAAGATCTTTTTTCATGGACTGTAGGTATGGAGTACAGGTTGCATAAACAGTGCAGTCCTAGGAAGCATTTGGGGTCATGTCAGTGTCTATGAGTTACCTGGCATCAAATGCTCTAGGTGCACAAATCCcataggttgtcacaagaaagacagtggattgtcagtgacactgacaggaaaactgcctgttaactgacatgtgtggacaaatcatggctaagtggtgattctttctgtgtctctacaggctctgtgagcgggacccctatcagctctaccagcggttggagcaacaagcccgggaatatgtgctggagatgaaggtccgcctgcttcggcagctctctgctgcagccaaggccaaggcaccgtctggcttgcagggcccacctcaggcacaccactttgtctccctactcctggaggagtatgctgccctttgccaggcagcacgatccatcagtacctttcttggcactctggtgagagaccatatccacttctttcctggcTGCTGAGGTGAACATAAGAACAAAAGCATTTGGTAGGGAGATAATATGCAGCCAGGGGACTGATCATATGGTTAAGCCCTCCTTGTATGATCACAGAGTCCTTTGCACACAAGGTGTGGTAGGATTGTTAGTTTAATGGAATTTGCTAGCAGAGAGAAGCATTTAGAGAATTAATGTCCAGGAGCCATAGGATGAAAATCTGTTTGGGAAAACCTGAGCACTAGGAAGTTAGACACTAGGATATGGAGGTGAGAACAGTGATACA
This mutation is a 383 bp deletion beginning at Chromosome 5 position 34,426,149 bp and ending after 34,426,531 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48089 | CGA TCC ATC AGT ACC TTT CTT G | Wild type Forward | A | |||
| 48090 | GCT GCA TAT TAT CTC CCT ACC A | Common | A | |||
| 48091 | TTG GGG TCA TGT CAG TGT CT | Mutant Forward | A | |||
| 48092 | Fluorophore-1 | ACT CTG GTG AGA GAC CAT ATC CAC | Quencher-1 | WT Probe | ||
| 48093 | Fluorophore-2 | CTA GGT GCA CAA ATC CTG CTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48089 | 0.40 uM |
| 48090 | 0.40 uM |
| 48091 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.