For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:21557048+21557150 103bp TCTTCCCTCATCTACATCCTGT GGAATGTCAACAGACCCTGA
Mut= 112 bp
Wt= 103 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TTTTTATTTTTTTGGTTTTTTGAGATAGAGTTTCTCTGTGTAGCCCTGGCTATCCTGGAACCCACTCAGTAGACCAGGCTGGCCTCGAACTCAGAAATCCACCTTCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCATGTGCCACCACGCCCGGCTACGTTTTGATTTTTTTTAATTTTTTGATTATTTTGATGATAATAGTCTTCCCTCATCTACATCCTGTCTCCTTATATCCAGAAAAGCATCCTACCCTGTAgcacaccgttgaacaataattttttatttcagggtctgttgacattccgagatgtggctgtggacttctcccaagaggaatgggaatgcctggactctgctcagagggctttgtacattgatgtgatggtagagaattatagcaacctggtctctgtgggtgagaacattttggttgtacaattcttaactcattctttgtaagtactggcccTATAGGCTGTAAACTCTATTAAGCTGTCATGGAAAAAAACAAGCCTAGACAAAGTTCAATAATTAAAAAGAAATTTTCCAAGAGGTTCAGCTGCCAACGCTAGCAGAAGACAGCCAGAGGGTGTGACTACTATGAGCTAGTAAGCATGTGATGGAGACACCGGACACAAAGAGAAGCATAGTGATTCGTGCTCTCGGAAGAAGAACTGGAACTGAAGATGGAAGCTCAGTGAGGAACAGCCTGATGTGAGAGGCCTGTGCTGCCACATGAGGC
This mutation is a 213 bp deletion beginning at Chromosome 17 position 21,557,103 bp and ending after 21,557,315 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48058 | TCT TCC CTC ATC TAC ATC CTG T | Common | A | Common | ||
| 48060 | GGA ATG TCA ACA GAC CCT GA | Wild type Reverse | A | Wt R | ||
| 48061 | GAA CTT TGT CTA GGC TTG TTT | Mutant Reverse | A | Mut R | ||
| 48062 | Fluorophore-1 | CAC ACC GTT GAA CAA TAA TTT TTT A | Quencher-1 | WT Probe | ||
| 48063 | Fluorophore-2 | CCT ACC CTG TAT ATA GGC TGT AAA CTC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48058 | 0.40 uM |
| 48060 | 0.40 uM |
| 48061 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.