For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:137885308+137885444 137bp GCTGGAAGTAGCACGCATTG CTGAGCACGCCCTCTACTTG
Mut= 138 bp
Wt= 137 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case; and insertions with carrots ^g^ (TTCATAGC & T insertions):
GAGGGTTTTACTGTGTAGCTCTGGCTTTCCTGTAGTTCACAAAGATCTGTCTGTCCAGCTCTGACAAGCAACCTGTTACTTAAAGAGACATTATGAAGCCTGAACTGGTGGCTTGTGTTTGTAATCCCGGCACCGGGAAACTAAAGCAGAGTTGAGAGTTCAAAGCCGGATTGGGCCACGTAATTCTAGGTCAGCCCCAACTGCATGGTAAGGTCATGCCTAAACAAAGGGAAAAACATAACAACAATCTCCCCTCCCTAATAAAAAAGATAAAGGAGGACGAGGCCATGT^ttagtctctccagaagagctcatcttgtctgctttgtcttttttccggagccctttgtctctgtgtcctgatgtgagtaggttgaagtgtcctttatctctctttacacagcgttattggaaataattatgaaaaacggcagcaccgctggaagtagcacgcattgccgaaaacctcctgggagcagcgaccagagcaagcccagctgtggaaaggacggcacttctggtgctggggaaggcgggaaagtctataccaaagaccaagtagagggcgtgctcaggtaggtgtgaatgcgagtgtgtccgcaccatgatcgttgactgtgattggacccaatcgacgttataatgcctaaaataaaaatgtatttatatatagcacagtttaatagag^GGAAATGAAGG^AGTTACCTGGGTGCCCTGTCCTTCATTATTTTGAAGTCAGCCTGGAGGGAGTTAACTTTCTGGAAGTTTCCACTCATTTAAATTAGCTATAAGTCACAGTGAGTTTTTAAAATAATGATCTCAGCTTTGAGTCTATGCACTGTTTGGACTGTAGTATTGAATGGATTGCTTTGTTGTGATACGTAGTTGAAAATAGGAGAATTTCATATGCGGGAAGGCT
This mutation is a 396 bp deletion beginning at Chromosome 3 position 137,885,162 bp and ending after 137,885,557 bp (GRCm38/mm10). In addition, there is an 8 bp insertion (TTCATAGC) at the deletion site and a single bp insertion (T) 11 bp before the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48011 | GCT GGA AGT AGC ACG CAT TG | Wild type Forward | A | |||
| 48012 | CTG AGC ACG CCC TCT ACT TG | Wild type Reverse | A | |||
| 48013 | TCT AGG TCA GCC CCA ACT GC | Mutant Forward | A | |||
| 48014 | CCC AGG TAA CTT CCT TCA TTT C | Mutant Reverse | A | |||
| 48015 | Fluorophore-1 | CTC CTG GGA GCA GCG AC | Quencher-1 | WT Probe | ||
| 48016 | Fluorophore-2 | CGA GGC CAT GTG CTA TGA A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48011 | 0.40 uM |
| 48012 | 0.40 uM |
| 48013 | 0.40 uM |
| 48014 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.