For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:30727524-30727667 144bp AATCCTCGGACTTAGGTCTCAC TCTAGTGTGTTCATTCCTTAGCTTG
Mut= 158 bp
Wt= 144 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GAGACAACGCTTAGGGACTATGCCCGAATACCTTAGAAGGGATGCAAGGCCAGAAAGGCCCTGATGCAACTTTTTCTTACAACTGTTGTAAAATGAGAAAACCTCTTAGTGCGATATTTCACCCACAGGGTGTCGCAGGGTGCTGCCTAGGCATTTTTAGACATCAGATTCCCCcgtgaacttctagacttttagaaaccaggccacttgccctctatctcccaagatcacgtgatcttgccacttacacctagaatgacccctagaacccagcgtcatatcctctacttgcacacttactttccacagtatccacatagttttttgtttgtttgtttcggtttttaatctccctcaccttccagtgacctttctactttctgatctcagatgttgttcttggccactttcttccccacctgggaaggtggcatctatgacttcattggggtaagttgaacaagggaagggcaaggaagagtgcaggagtcggttcacctggtccccgtgtttactcgagcctctacctgacccacaggaattcatgaaggccagtgtggatgtggcagacctgataggcctaaaccttgtcatgtctcggaatgcaggcaagggggagtacaagattatggttgctgccctgggctgggccactgctgaactcattatgtcccggtgtgtggagcaaactggagcccagacttccgggaatggacagctgggtcccacaggggtgctgaggggaggtgatcagaggctgggtgctgggggtgggggagtctgggtactagagactgcctccttttgccttcctcagatgcatccccctctgggtgggagcccgaggcattgaatttgactggaaatatatccagatgagcattgactccaacatcagtctggtatgcagtctagccctagcctacctttatgttgttagccatacttctcccaaaaacttggctccaacttcccagtcccttcctgcctccctgcaggtccactacatcgttgcatcagctcaggtctggatgataacacgctatgacctgtaccacaccttccggcctgctgttctcctcctgatgttccttagtgtctacaaggcctttgtcatggagtgagctgggtggggtatgaggctgggttcaaatgggggtgtgttttctctctccttttcctcattgtgatgtttccccacaggaccttcgtccacctcttctccttgggtagttggacagcactgctcgcccgggcagtagtaacaggactgctggccctcagcaccttggccctgtatgttgctgttgtcaatgtacactcctagcttgacatctcaggtgttggcgaaccttttcatttcctctctccagatttcagtgaagtaaacagtgtttggaaaggtttttgttatgtccatctctctctctcagaaaccgaatcctcggacttaggtctcacagagtctgtctggcttcagaaccagataaataagctggaatgttggccagtcttcctggtttccccatgagaacctgggggcTTGGTAATCATTGAACAAGCTAAGGAATGAACACACTAGAGTTCAGGAGGGGGCTTTGGGGTAGAGGGGCATTCTTCCTCAACTTACAGCTTGGTTTGAGCCCTCTTCCATGGTGAGTCTTCCCAAAACTGGTTACCTCCAACTTTGCAACCCCCCATTTCTCCACTCTAGTCCATCCACCATGTAACAGCTAGGG
This mutation is a 1369 bp deletion beginning at Chromosome 7 position 30,727,564 bp and ending after 30,728,932 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47837 | AAT CCT CGG ACT TAG GTC TCA C | Wild type Forward | A | |||
| 47838 | TCT AGT GTG TTC ATT CCT TAG CTT G | Common | A | |||
| 47839 | GGC CCT GAT GCA ACT TTT TC | Mutant Forward | A | |||
| 47840 | Fluorophore-1 | AGC TGG AAT GTT GGC CAG T | Quencher-1 | WT Probe | ||
| 47841 | Fluorophore-2 | CCC ACA GGG TGT CGC A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47837 | 0.40 uM |
| 47838 | 0.40 uM |
| 47839 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.