For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:120283677-120283801 125bp TCAGGTCAAGGTAAATGTCAC TGAGTTCTGGGAGTGCTGGA
Mut= 104 bp
Wt= 125 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CTGACCGCTGAGGGCTTGGGGGTCTCTTTGCAGGAGGAGGCCTCTGTCTTCTGCCGGCTCACTGTGAAAATCCTGGAGGCTCGGAGTCTGCCCAGGGCTGACCTGTGTGAGTGACTGTGGGTGGGGCCTGGATCCCAAGGGAAAGGACCAAATGATCTTTGAGGTGGGGCTTAGCTGCTCTCAGGGGATACTGGGGTTGTCAAAGGAACCTGGACCAAATCCCTGGAaaggatgtatagaatccactctcttctgatgcctggtccccttgactttgtcagtgagtcaggcagatccctatgtgactgtgcagctgccaacagcttctggaatgaaattcaagacccaaacagtcactaactccagtcatcctgtgtggaacgagaccttcagtttcctcatccagagtcaggtcaaggtaaatgtcacgtgggtgtcgcaccagccactcactcgtagaacagtccatcccccttccctccacatgaggaccttgggaacaaGTGGGATTGCTCCAGCACTCCCAGAACTCAGGGGAGGAGGGTGTCTGTGCTCCAGACTCTATGTGCTGTGAGCAAGAATGCGGCCCTGCAACTCCCTGGCTGTGGGACTGACGTTTGGCAAGCTGAAGCTTCTGGGGAGCCCATCTCTGATCTGTGGATAGAAAGCATTCCTTTTTAATGGGGCTGCTGCAGGGCTGAAGGGAAATTACATAGAAAGGGATCGCAAAGTA
This mutation is a 276 bp deletion beginning at Chromosome 2 position 120,283,707 bp and ending after 120,283,982 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47698 | TCA GGT CAA GGT AAA TGT CAC | Wild type Forward | A | |||
| 47699 | TGA GTT CTG GGA GTG CTG GA | Common | A | |||
| 47700 | GAT CTT TGA GGT GGG GCT TAG | Mutant Forward | A | |||
| 47701 | Fluorophore-1 | ACC AGC CAC TCA CTC GTA GAA C | Quencher-1 | WT Probe | ||
| 47702 | Fluorophore-2 | TGG ACC AAA TCC CTG GAG T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47698 | 0.40 uM |
| 47699 | 0.40 uM |
| 47700 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.