For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr15:102083876+102084018 143bp AACTCAGATGTAAAGGTGTGTGC GTCATAGTGTAGAGGCTGGCTCA
Mut= 148 bp
Wt= 143 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case; and insertion with carrots ^g^ (G insertion)):
AGTATTTTCTTGTCTTTTGCTTCAGTGGCACAGCCTTGTTTTGACTTGGCTTGGTGTTGGCATGAATCTCTGGCTCTAATCTTATATGCATGTGGATCTGTGGGAGTTGGTTTGAAGGATTTTGCTTTTTCAAGACAGGATTACTCTGTGTAGCCCTGGCTATGCTAAGACTCACTCTCTAGGCTGGACTAGCCTTGAACTCAGATGTAAAGGTGTGTGCCACCACCTTCCAGCATGTGCTTTTTAATACAGAATCTCTTTTTTATAGTAGTGACTGgtctggggttcactgtgaatattgggctggtctcagactttgagccagcctctacactatgactgctggattttgggttgttttgagatggtcttagcctgtaacccgggctggatttgctcacatttatcctactgtctcagttactcaggtgctctgccatgcttggcttcttaatttccttttgtctgctcttctgtcctagtgtcaacaacttggcatagtaacgatgatgacgtgtacagggcgcctccaattgaccgttccatccttcccactgctccacgggctgctcgggaacccaatattgaccggagccgtcttcccaagtcgccaccctacactgctttcctagggaatctgccctatgatgtgacagaagactccattaaggatttctttagaggattaaatGTAAGTGTCTTTTTGTGTCAAAC^TGTGGGATATTGAGGATAAAAGCTAAATAAACCGATTGTGGGATGGGCCACAGAGGAAGGCAACAGAGTCCAAGATGCAAAGAATACCTTAATTAATTTTGTTTTAAGGGTTAAATTACTATGACTTGAACAGTGTGGGCTATAGAGTAATTTGTCTTCTGCCCCTCTACCCATTTTTCTCCCAGGTTCTTATATGTTCTTTGGAGAAATTACTTTTTGTTTGGGTTGGTTTGTTTGTTTTT
This mutation is a 414 bp deletion beginning at Chromosome 15 position 102,083,956 bp and ending after 102,084,369 bp (GRCm38/mm10). In addition, there is a single bp (G) insertion 13 bp after the deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47693 | AAC TCA GAT GTA AAG GTG TGT GC | Common | A | |||
| 47694 | GTC ATA GTG TAG AGG CTG GCT CA | Wild type Reverse | A | |||
| 47695 | CCC ACA ATC GGT TTA TTT AGC | Mutant Reverse | A | |||
| 47696 | Fluorophore-1 | CAC TGT GAA TAT TGG GCT GGT C | Quencher-1 | WT Probe | ||
| 47697 | Fluorophore-2 | CAA ACG TGT GGG ATA TTG AGG A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47693 | 0.40 uM |
| 47694 | 0.40 uM |
| 47695 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.