For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:100293641+100293723 83bp GAGCTTGCTGCTGAGGGCTC CCCTCGCCTCCAAACACAG
Mut= 96 bp
Wt= 83 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AGCCCATGTGCTGCTCTTTGTACCCTCTCAGGTTACCTGGGCACGCTCACACACACACACACACACACACACACAAGCGCACACACTCACACACACATATACACACAACACACATGTATCCACTCATGCACACACATTCATGCATGCACATGTACACACACATGCACACACAAACACACACAATCTTTAACTAAAAGAATCCATTGTGTCCCAGGAGATGAGCTTGCTGCTGAGGGCTCTTTGagcaggtggtcaggtctcacatgagtgaaatgcccattgcctgtgtttggaggcgagggtcacagtctttctatttttacagctctgaaggatggctatgagaaggtagagcaagaccttcctgcctttgaggacctcgagggagcagcaagggccctgatgcggctgcaggatgtgtacatgctcaacgtgaagggcttggctcgaggcgtcttccagagggtcacgggctcctccatcaccgacctgtacagtcccaggcagctcttctctctcacagcggatgactgcttccaagttggcaaggtgacatgcaaagaagtccaactgctcgattctactttcttatggatggactgtgtctcagctgtctttaggtattccctttgcttgaggtaatgacAGGGTAGATCACTAAGACTGCATTGCAAAGTAGGAGGAGCTAAATTGAACCCCATCTTTTAGCTTCCCATGCTCTTGCCATAGGGATGAGAAGTCATCATATACTTAGGGCACAAGAAAAGCTTTTCTTTTCTTTCCAACAGGATATTGTGTATCCCAGGCTGGTGTTAAACTTGCCAGGGTCTTCCTGCCTCTACTTCTCCAGTGCTGGGATTACACCATGCCCATTTTTGCAGGGCTAGAAATCAAACCCAGGGTCTCATGTGT
This mutation is a 403 bp deletion beginning at Chromosome 7 position 100,293,665 bp and ending after 100,294,067 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47673 | GAG CTT GCT GCT GAG GGC TC | Common | A | |||
| 47674 | CCC TCG CCT CCA AAC ACA G | Wild type Reverse | A | |||
| 47675 | GCA TGG GAA GCT AAA AGA TGG | Mutant Reverse | A | |||
| 47676 | Fluorophore-1 | AGC AGG TGG TCA GGT CTC AC | Quencher-1 | WT Probe | ||
| 47677 | Fluorophore-2 | CTG CAT TGC AAA GTA GGA GGA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47673 | 0.40 uM |
| 47674 | 0.40 uM |
| 47675 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.