For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:72556493+72556589 97bp GCCCACGAAAGCTATTTACC GGGGACACTGAAGCAAAACA
Mut= 95 bp
Wt= 97 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AAGCATCTACATCTTTGGGATTTTCCGAAACCCTTTCTATCCGAAGGATATACACGCTGTGTCTGTATTCTATGACAAGCAAAACAAGCTCCTGAAGATTGGTGCTGTCAGATGGATTTTGCTAACTCTAGGTAGGAAGGTTCTATTTATCAACTCTTACAAACTGTAGTTAGGGAAGACTGCTCACATTTATGAAATAGACATAATCTTTATGTATGATTTTTTTGTTGTTGTTTATTAGCTTTTCAGCTAATTGCTTAAATGTGCCCACGAAAGCTATTTACCAAGATAAActgtggtaggagcagtttctgcagtagtcagactcaccatgcattggtctgttttgcttcagtgtcccctttggcaatggtggccttccttgcgctggacagctccttacacgggctccactctgtgtctgtctccattggattcaccagggctttcagaatggtaattccagtgtgcactgtgaagcacggccggtgGCTGAGTGTAACTGTGGTTTTTATTAACAGTTTGCTTAGATTGCTGAATTCTACCTGAAAGTGGATCATTTGTATACTGTAGGTGTGGCAGAATACAGAAACTGCTTTACTGGAGACTGTGGTTGTATCAGCAGTGCACATGGTGTCCAGCACAGACTGCTGGTGGAACAGGAGCCTTGATACAGGAATCAGGCTGTTATTGGTAAGTGCATTTTTAACAGCTCTGTTGAGAGATTTTTTTTTTTTAACTCACAATCAAACTCATCCAATTGAAGGCTTCTT
This mutation is a 198 bp deletion beginning at Chromosome 12 position 72,556,521 bp and ending after 72,556,718 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47640 | GCC CAC GAA AGC TAT TTA CC | Common | A | |||
| 47641 | GGG GAC ACT GAA GCA AAA CA | Wild type Reverse | A | |||
| 47642 | GAT CCA CTT TCA GGT AGA ATT CAG | Mutant Reverse | A | |||
| 47643 | Fluorophore-1 | CAG TAG TCA GAC TCA CCA TGC AT | Quencher-1 | WT Probe | ||
| 47644 | Fluorophore-2 | AAA GCT GAG TGT AAC TGT GGT TTT TA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47640 | 0.40 uM |
| 47641 | 0.40 uM |
| 47642 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.