For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:69736202+69736293 92bp GGGTTTAGATGTGTCCTGTGC ACCGTAAGTGAGGCTGTGCT
Mutant= 105 bp
Wild Type = 92 bp
Sequence
Wt Sequence (deletions in lower case):
CAATACAACAGAACATCATACAACCAGGAATATTTAATAAAAACCTAGTGACAAGTAGAAATACAAGTGGATAGAAATAACTCTAAATGTCAACTGCATGCACTCACTGTCTTCAGCAgtcaataggtatggcttttatattccgaacaagcttttgtaaaactcgtatgggaaaccctttgcactcatgaggttctgctatataagggtatcacatgatttcttattttcagtacactttttttgtttttatagaagctaactttgtttttctgtttttattttatctgatgaatcccaaaagaacaacaaaaccaactcctcatttagatgggtaaagattattttaatatcttacaacatactttattttgttgtattagagtaagaagcttttatttaataatttttacatgacattttaggcatcatgttgtttttgggcaagtgatctctggtcaggaagttgtgagagagattgaaaaccagaaaacagatgccgctagcaaaccatttgctgaagttcggatactcagttgcggagagctgattccaaagtctaagggtaagaacgggtgcacagttaagggaactcttacttggataagtagagattataaataagcatgaggttttgtgggtttagatgtgtcctgtgctgtcagttttttctaatttatatgtgcttctgtacgtatgtGTCTGGGTCAAGCACAGCCTCACTTACGGTTCTTCAGAAGGCATGGACCATATACTGTAAGTACAATATACAATAAGAAAATTATAGTTGTGAAGAACTTTGT
This is a 582 bp deletion beginning at Chromosome 2 position 69,735,682 bp and ending after 69,736,263 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47620 | CCT AGT GAC AAG TAG AAA TAC AAG TGG | Mutant Forward | A | |||
| 47621 | GGG TTT AGA TGT GTC CTG TGC | Wild type Forward | A | |||
| 47622 | ACC GTA AGT GAG GCT GTG CT | Common | A | |||
| 47623 | Fluorophore-1 | TTT ATA TGT GCT TCT GTA CGT ATG TGT CT | Quencher-1 | WT Probe | ||
| 47624 | Fluorophore-2 | CAC TCA CTG TCT TCA GCA GTC TG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47620 | 0.40 uM |
| 47621 | 0.40 uM |
| 47622 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.